ID: 1122874577

View in Genome Browser
Species Human (GRCh38)
Location 14:104657941-104657963
Sequence CAGGAGACACAGATCTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122874576_1122874577 -6 Left 1122874576 14:104657924-104657946 CCTCAGGAACTGCGGTTCAGGAG No data
Right 1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122874577 Original CRISPR CAGGAGACACAGATCTAGCA AGG Intergenic
No off target data available for this crispr