ID: 1122878642

View in Genome Browser
Species Human (GRCh38)
Location 14:104680079-104680101
Sequence GGAGGCTTTGAGTGCAGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122878642_1122878646 -2 Left 1122878642 14:104680079-104680101 CCCGAGCTGCACTCAAAGCCTCC No data
Right 1122878646 14:104680100-104680122 CCGTCACCTTTCCGTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122878642 Original CRISPR GGAGGCTTTGAGTGCAGCTC GGG (reversed) Intergenic
No off target data available for this crispr