ID: 1122878664

View in Genome Browser
Species Human (GRCh38)
Location 14:104680185-104680207
Sequence TTCCCTGCACACAGCTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122878662_1122878664 -1 Left 1122878662 14:104680163-104680185 CCTCAGTGTGTGCAGAGGAGCCT No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878652_1122878664 30 Left 1122878652 14:104680132-104680154 CCCCTCCGTCTTCTGACTCTCAC No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878661_1122878664 2 Left 1122878661 14:104680160-104680182 CCACCTCAGTGTGTGCAGAGGAG No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878660_1122878664 3 Left 1122878660 14:104680159-104680181 CCCACCTCAGTGTGTGCAGAGGA No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878653_1122878664 29 Left 1122878653 14:104680133-104680155 CCCTCCGTCTTCTGACTCTCACC No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878654_1122878664 28 Left 1122878654 14:104680134-104680156 CCTCCGTCTTCTGACTCTCACCC No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878655_1122878664 25 Left 1122878655 14:104680137-104680159 CCGTCTTCTGACTCTCACCCCTC No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878656_1122878664 8 Left 1122878656 14:104680154-104680176 CCCCTCCCACCTCAGTGTGTGCA No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878658_1122878664 6 Left 1122878658 14:104680156-104680178 CCTCCCACCTCAGTGTGTGCAGA No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data
1122878657_1122878664 7 Left 1122878657 14:104680155-104680177 CCCTCCCACCTCAGTGTGTGCAG No data
Right 1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122878664 Original CRISPR TTCCCTGCACACAGCTGAAG TGG Intergenic
No off target data available for this crispr