ID: 1122879130

View in Genome Browser
Species Human (GRCh38)
Location 14:104682166-104682188
Sequence CTGCTATTCTACAGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122879124_1122879130 -10 Left 1122879124 14:104682153-104682175 CCCGTAAGTCTCCCTGCTATTCT No data
Right 1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122879130 Original CRISPR CTGCTATTCTACAGGAGAAA GGG Intergenic
No off target data available for this crispr