ID: 1122880788

View in Genome Browser
Species Human (GRCh38)
Location 14:104689643-104689665
Sequence CGGAGCGCGGCAGTGGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 218}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122880767_1122880788 24 Left 1122880767 14:104689596-104689618 CCGCCCCGCCCGCCCCGCGCCCG 0: 2
1: 4
2: 61
3: 443
4: 2617
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880774_1122880788 12 Left 1122880774 14:104689608-104689630 CCCCGCGCCCGCCAGGAGCCACC 0: 1
1: 0
2: 0
3: 21
4: 249
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880782_1122880788 -9 Left 1122880782 14:104689629-104689651 CCGTCCGAGCCTTGCGGAGCGCG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880779_1122880788 1 Left 1122880779 14:104689619-104689641 CCAGGAGCCACCGTCCGAGCCTT 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880769_1122880788 20 Left 1122880769 14:104689600-104689622 CCCGCCCGCCCCGCGCCCGCCAG 0: 1
1: 2
2: 15
3: 161
4: 1103
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880778_1122880788 4 Left 1122880778 14:104689616-104689638 CCGCCAGGAGCCACCGTCCGAGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880773_1122880788 15 Left 1122880773 14:104689605-104689627 CCGCCCCGCGCCCGCCAGGAGCC 0: 1
1: 0
2: 5
3: 56
4: 480
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880776_1122880788 10 Left 1122880776 14:104689610-104689632 CCGCGCCCGCCAGGAGCCACCGT 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880765_1122880788 28 Left 1122880765 14:104689592-104689614 CCGCCCGCCCCGCCCGCCCCGCG 0: 1
1: 4
2: 64
3: 451
4: 2791
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880777_1122880788 5 Left 1122880777 14:104689615-104689637 CCCGCCAGGAGCCACCGTCCGAG 0: 1
1: 0
2: 2
3: 8
4: 106
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880770_1122880788 19 Left 1122880770 14:104689601-104689623 CCGCCCGCCCCGCGCCCGCCAGG 0: 1
1: 3
2: 19
3: 130
4: 974
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880772_1122880788 16 Left 1122880772 14:104689604-104689626 CCCGCCCCGCGCCCGCCAGGAGC 0: 1
1: 0
2: 6
3: 53
4: 607
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880781_1122880788 -6 Left 1122880781 14:104689626-104689648 CCACCGTCCGAGCCTTGCGGAGC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880768_1122880788 21 Left 1122880768 14:104689599-104689621 CCCCGCCCGCCCCGCGCCCGCCA 0: 1
1: 5
2: 23
3: 238
4: 1445
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880775_1122880788 11 Left 1122880775 14:104689609-104689631 CCCGCGCCCGCCAGGAGCCACCG 0: 1
1: 0
2: 2
3: 18
4: 218
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880764_1122880788 29 Left 1122880764 14:104689591-104689613 CCCGCCCGCCCCGCCCGCCCCGC 0: 4
1: 11
2: 87
3: 638
4: 3376
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218
1122880766_1122880788 25 Left 1122880766 14:104689595-104689617 CCCGCCCCGCCCGCCCCGCGCCC 0: 2
1: 7
2: 106
3: 659
4: 3609
Right 1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG 0: 1
1: 0
2: 1
3: 32
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122880788 Original CRISPR CGGAGCGCGGCAGTGGGCGC CGG Exonic
900091779 1:923954-923976 GGGCGCGCGCCAGTGGACGCGGG + Intergenic
900384294 1:2402531-2402553 GGGAGCGCAGCTGTGGGAGCGGG + Intronic
900494458 1:2970220-2970242 AGGAGGGCGGCCCTGGGCGCGGG + Intergenic
903263301 1:22142752-22142774 CGGCGCGGGGCAGCGGGCGCGGG - Intronic
903462864 1:23531300-23531322 CGGAGCGCGGCATTTTCCGCGGG - Intergenic
903566053 1:24266629-24266651 CAGGGTGGGGCAGTGGGCGCTGG - Intergenic
905037916 1:34929600-34929622 CGCCGAGCGGCAGCGGGCGCGGG + Intergenic
905960092 1:42035909-42035931 CGTGGCGCGGCGGCGGGCGCGGG + Intronic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
908355880 1:63324232-63324254 GGGGGCTCGGCGGTGGGCGCTGG + Exonic
915339073 1:155166618-155166640 GGGAGCCCGGCAGTGGGAACGGG + Intergenic
915351151 1:155227132-155227154 CGGAGCGCGGCAACGAGCGCCGG - Intergenic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
916179146 1:162069541-162069563 CGTCGCGCGGCCGGGGGCGCGGG + Intergenic
916729469 1:167553402-167553424 CGGAGAGCTGCAGCGGGCTCAGG + Exonic
919724459 1:200872994-200873016 CGGAGTGCAGCCCTGGGCGCAGG - Intergenic
921024049 1:211260554-211260576 CAGAGCGCGGCCCTCGGCGCCGG - Intronic
1063619909 10:7637232-7637254 GGCAGAGGGGCAGTGGGCGCGGG - Exonic
1064418241 10:15168736-15168758 CGGAGGGCGGGACGGGGCGCGGG - Intergenic
1068633110 10:59318659-59318681 CGGAGGGAGGCAGTGGGTGTGGG + Intronic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1072654636 10:97321243-97321265 CGGAGCGCGGCCAGGGGCGGTGG - Exonic
1072719447 10:97771755-97771777 GGGGGCGCTGCACTGGGCGCCGG - Exonic
1074502978 10:114043491-114043513 CGGGGCGCAGGAGTGGGTGCGGG + Intergenic
1076637188 10:131889801-131889823 CTGGGCCCGGCAGTGAGCGCGGG - Intergenic
1077540203 11:3143055-3143077 CGGAGCGGGGCAGAGGAGGCAGG + Intronic
1077540262 11:3143254-3143276 CGGAGCGGGGCAGAGGAGGCAGG + Intronic
1077923109 11:6655897-6655919 CGGAGCGCGGGTGGGGGCGGGGG - Intergenic
1080458462 11:32435033-32435055 CGGCGCGGCGCAGTGGGCGCCGG - Exonic
1083389525 11:62337693-62337715 AGGCGGGCGGCGGTGGGCGCGGG + Intronic
1083965762 11:66042797-66042819 AGCAGCGCCGCAGTAGGCGCTGG + Exonic
1084266932 11:68010011-68010033 AGGAGTGGGGCAGTGGGCCCTGG - Intronic
1084295931 11:68213438-68213460 CGGGGCGCGGGGGCGGGCGCCGG - Intronic
1090472141 11:126990071-126990093 TGGAGCGGGGCAGGGGGCACAGG + Intronic
1091545413 12:1498510-1498532 CGAGGCGCGGCCGTGGCCGCAGG + Intergenic
1092817757 12:12326165-12326187 CTGAGCGTGGCAGTGGGTACAGG - Exonic
1094025777 12:25958753-25958775 CGGGGCGCGGCGCGGGGCGCCGG - Intergenic
1096106520 12:48999356-48999378 CGCGGCTCTGCAGTGGGCGCCGG - Intergenic
1096461136 12:51821851-51821873 AGGAGCGCGGCCGGGGGCGGCGG + Intergenic
1096518826 12:52172758-52172780 AGGAGGGAGGCAGTGGGCTCTGG + Intronic
1098029008 12:66235293-66235315 CGGGCCGCGGCGGCGGGCGCGGG + Intronic
1098426026 12:70366413-70366435 CGGAGGCTGGCAGGGGGCGCTGG + Exonic
1104708363 12:130966562-130966584 CTGAGAGCGGCTGTGGGCGCGGG + Intronic
1104834168 12:131776644-131776666 CAGCCCGCGGCAGTGTGCGCAGG - Intronic
1104980135 12:132570033-132570055 CAGGGCGCGGCATGGGGCGCGGG - Exonic
1105049712 12:133037603-133037625 AGGCGCGCGGGAGTGGCCGCGGG + Exonic
1105349341 13:19601889-19601911 CGGGAAGCGGAAGTGGGCGCGGG - Intergenic
1106498792 13:30307494-30307516 CGCAGCGCGGGAGGGAGCGCGGG + Intergenic
1106517170 13:30465413-30465435 CGGAGCGCGGCCGGGGCGGCGGG - Intronic
1113737643 13:112689919-112689941 GCGAGCGCGGGTGTGGGCGCGGG + Intergenic
1113922462 13:113920843-113920865 AGGAGCGATGCAGTGGGCACAGG - Intergenic
1115120027 14:29927753-29927775 CGGAACGCGGCAGCCGGCTCGGG + Intronic
1120521704 14:85533189-85533211 CGGAGCGCGCCAGAGCGCGAGGG + Intronic
1120881298 14:89417017-89417039 CGGGGGGCGGCCGCGGGCGCGGG + Intronic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122697493 14:103563084-103563106 CGGAGCGCGGCGCCGAGCGCAGG + Exonic
1122880788 14:104689643-104689665 CGGAGCGCGGCAGTGGGCGCCGG + Exonic
1122975841 14:105170404-105170426 CATAGTGGGGCAGTGGGCGCAGG - Intergenic
1123018019 14:105384753-105384775 CGAAGCGCGGCAGGGCTCGCTGG - Intronic
1123024049 14:105415247-105415269 CGGGGCGCGGAACGGGGCGCGGG + Intronic
1123684228 15:22786297-22786319 CGGAGCGCGGCAGGACGCACCGG - Intronic
1124640128 15:31391926-31391948 CCGAACGCGGCAGTCCGCGCAGG - Intronic
1124696850 15:31870674-31870696 CGGAGCGCGGGAGGAGGCGGGGG - Intronic
1124790111 15:32718787-32718809 CGGGGCGCGGCCCTGGCCGCGGG + Intronic
1125524779 15:40368055-40368077 TGGCGCGCGGCTGTGCGCGCCGG + Exonic
1125603649 15:40928426-40928448 TGGGGGGAGGCAGTGGGCGCAGG + Intergenic
1128514478 15:68333832-68333854 GGGAGCACTGCAGTGGGAGCAGG - Intronic
1132330386 15:101008559-101008581 CAGAGGGCGCCGGTGGGCGCGGG - Intronic
1132527728 16:425932-425954 CAGGGCGCGGCGGCGGGCGCGGG - Exonic
1132527869 16:426321-426343 CGGAGCGCGGCCCTGGGCCCGGG - Exonic
1132544794 16:528095-528117 CGGAGGGCGGCGGGGAGCGCGGG + Intronic
1132591156 16:727043-727065 CTGAGCGCGGCGCTGGGCTCGGG - Intronic
1132663401 16:1071325-1071347 AGGTGCGAGGCAGTGGGAGCTGG + Intergenic
1132703819 16:1232656-1232678 CGGAGTCCGGGAGTGCGCGCGGG + Intergenic
1132707699 16:1253739-1253761 CGGAGTCCGGGAGTGCGCGCGGG - Intergenic
1133234237 16:4380401-4380423 CGGAGCGTGGCAGCAGGAGCCGG + Intronic
1136008124 16:27345031-27345053 CGGAGTGCGGCAGGGGTGGCTGG + Intronic
1138651638 16:58464259-58464281 GGGAGCGCGGCGTTGGGGGCGGG + Exonic
1139446314 16:67000813-67000835 CTGAGCGGGGCGGTGGGCGGCGG - Intronic
1141140382 16:81493255-81493277 CTGAGGGCAGCAGTGGGAGCTGG + Intronic
1141797929 16:86287098-86287120 CGGAGCGCGGGAGTGAGCGGCGG - Intergenic
1141841970 16:86579240-86579262 GGGAGCGGGGCAGGGGGCTCGGG + Exonic
1141989751 16:87602999-87603021 CGGAGCGCGGTCTCGGGCGCGGG - Exonic
1142055665 16:87994096-87994118 CGGAGCGCGGCGGTGTGCTGCGG + Intronic
1142192151 16:88723014-88723036 GGGAGGGCGGGAGGGGGCGCTGG + Intronic
1143164586 17:4891585-4891607 CTGGGCGTGGCAGTGGGTGCGGG - Exonic
1143598394 17:7929230-7929252 CGGAGGGCCCCAGCGGGCGCTGG + Exonic
1143719367 17:8799151-8799173 CGGAGGGCGGAGCTGGGCGCAGG + Exonic
1145077412 17:19867497-19867519 CGGAGCGCGCCAGCGTGCGGCGG + Exonic
1146176687 17:30669568-30669590 CGGAGTTCGGCAGTGGGGGCAGG + Intergenic
1146350151 17:32085683-32085705 TGGAGTTCGGCAGTGGGGGCAGG + Intergenic
1147134751 17:38428438-38428460 CGGGGCACGGCTGGGGGCGCCGG - Exonic
1147183867 17:38703607-38703629 CGGAGCGCGGCCGTCCTCGCCGG + Intergenic
1147261724 17:39212939-39212961 CGGAGGGAGGGAGTGGGCGGGGG - Intronic
1147382216 17:40062769-40062791 CGGGGCGCGGCAGGGGGCGGGGG + Intronic
1147448374 17:40488754-40488776 CTGAGGGGGGCAGAGGGCGCTGG + Exonic
1148713474 17:49698794-49698816 TGCAGCGGGGCAGTGGGGGCAGG + Intergenic
1148786908 17:50150035-50150057 CGGAGCGCCCCAGCGGCCGCAGG - Exonic
1151802034 17:76384475-76384497 CGTGGCCCGGCCGTGGGCGCGGG + Intronic
1152183443 17:78840038-78840060 TGGAGCGCGGCGCTGGGCCCCGG - Intronic
1153900676 18:9614670-9614692 CGGGGCGCGGCCGGGGGCCCGGG - Intronic
1155007326 18:21740992-21741014 CGGAGCGCGGCGGCTGGTGCGGG + Intronic
1155979088 18:32162224-32162246 CTGGGCGTGGTAGTGGGCGCCGG - Intronic
1156253823 18:35376958-35376980 CGGCGCGGCGCGGTGGGCGCGGG - Intronic
1157578860 18:48761715-48761737 CGCAGAGGGGCAGGGGGCGCGGG - Intronic
1158579938 18:58671936-58671958 CTGAGCGCGGCGGGGGCCGCCGG + Intronic
1160521913 18:79512694-79512716 CAGAGCGCAGCAGAGGGCACAGG - Intronic
1160557667 18:79736493-79736515 AGGAGCGCGGCAGGGGGCCGGGG + Exonic
1160631262 18:80247578-80247600 CGGGGCGCGGGCGCGGGCGCCGG - Intergenic
1160787687 19:908890-908912 CGGGGGGCGGCGGTGGGCGGGGG - Intronic
1160887010 19:1354849-1354871 CGGCGCGCGGCCGTGGACGCCGG + Intronic
1161052027 19:2169144-2169166 TGGAGCCCGGCTGTGGGCGGCGG + Intronic
1161068919 19:2250928-2250950 CGGACCGCGGCAGCAGGAGCAGG - Exonic
1161203685 19:3029343-3029365 CGGTGCGCGGGGGTGGGCGCGGG - Intronic
1161284944 19:3464040-3464062 CGGGGCGCGGGGGTGGGCTCTGG + Intronic
1161309720 19:3586841-3586863 CGGATCGAGGCAGTGTGCGTGGG + Exonic
1161962993 19:7533182-7533204 CTGAGCACAGCAGTGGGAGCAGG - Intronic
1162079354 19:8209296-8209318 CGGGGCGGGGCCGTGGGGGCGGG - Intronic
1162312145 19:9913909-9913931 CGGAGCCCGGCGGGGGGCGGGGG + Intronic
1162982128 19:14247319-14247341 TGGAGTTCGGCAGTGGGGGCAGG - Intergenic
1163637035 19:18441752-18441774 GGGAGCGCGGGGGTGGGGGCAGG - Intergenic
1164615779 19:29665954-29665976 AGGGGCGCGGCGGGGGGCGCTGG + Intronic
1164958436 19:32406071-32406093 CGGAGCGCGGGAGTGTCTGCCGG + Intronic
1165058524 19:33194127-33194149 GGGAGCGCGGCGGGGGGCGCGGG + Intronic
1165924893 19:39320820-39320842 CGGAGCGAGGCAGCGGCGGCGGG - Intergenic
1167045367 19:47046135-47046157 GGGGGCGCGGCCGTGGGCGCGGG - Exonic
1168485714 19:56760246-56760268 CAGAGCAGGGCACTGGGCGCAGG - Intergenic
927472666 2:23386772-23386794 CGGAGCGCGGGGCTGGGAGCCGG + Intronic
927751454 2:25673711-25673733 CGGGGCGCGGCCGCGGGGGCGGG - Intergenic
928172333 2:29011658-29011680 CGGAGGGTGGCAGCGGGCCCGGG + Intronic
929452844 2:42048209-42048231 CGGCGGGCGGCAGTGGCCGCGGG + Exonic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
933658176 2:84905941-84905963 GGGAGCGCGGAAGGGGACGCTGG + Intronic
934079205 2:88452757-88452779 CGGAGCGGGGCGGTGGCCGCGGG + Intergenic
937045159 2:118847205-118847227 GGGAGCGAGGCGGTGGGGGCGGG - Exonic
937278260 2:120700190-120700212 CGGAGCCCTGCAGTGGGGGAGGG - Intergenic
937905462 2:127050835-127050857 TGGAGGGCGGCAGTGGGGCCGGG - Exonic
938338981 2:130523010-130523032 GGGGGCGCGGGAGTGGGCGCCGG + Intronic
938338996 2:130523052-130523074 GGGGGCGCGGGAGTTGGCGCCGG + Intronic
938350842 2:130597698-130597720 GGGGGCGCGGGAGTTGGCGCCGG - Intronic
938350857 2:130597740-130597762 GGGGGCGCGGGAGTGGGCGCCGG - Intronic
938416120 2:131105202-131105224 CGGAAGGCGGCAGGGGGCGTGGG - Exonic
944819816 2:203419250-203419272 CGGGGCGCGGTGGTGGGCGCCGG - Intronic
948115825 2:235493985-235494007 CGGGGCGCGGGCGCGGGCGCGGG + Intergenic
948190158 2:236052026-236052048 CGGAGTGGGGCAGAGGGAGCGGG - Intronic
948874323 2:240819105-240819127 AGGAGCGGGGCGCTGGGCGCCGG - Intronic
1168760484 20:347060-347082 CGGGGCGGGGGAGGGGGCGCCGG - Exonic
1168883317 20:1225801-1225823 TGGGGCGGGGCAGTGGGCGAGGG - Intergenic
1168883332 20:1225841-1225863 CGGGGCGGGGCAGTGGGCGATGG - Intergenic
1168883354 20:1225901-1225923 CGGGGCGGGGCAGTGGGCGAGGG - Intergenic
1168883371 20:1225941-1225963 CGGGGCGGAGCAGTGGGCGAGGG - Intergenic
1171879768 20:30610160-30610182 CTGTGAGCGGCAGTTGGCGCTGG - Intergenic
1172684836 20:36745878-36745900 CGGGGCGGGGCAGAGGGCCCCGG + Intronic
1174136740 20:48385157-48385179 CTGAGCGTGGGGGTGGGCGCGGG + Intergenic
1176125351 20:63472511-63472533 CGGAGCGCGGGGGGCGGCGCGGG + Exonic
1177011041 21:15730314-15730336 CGGAGCGCGGCAGCCAGGGCCGG + Exonic
1180138716 21:45877919-45877941 CGGGAGGCGGCAGTGGGAGCAGG + Intronic
1182903705 22:33919962-33919984 CGGAGCGCGAGAGTCGCCGCGGG - Intronic
1184146523 22:42614671-42614693 AGGAGCGCGGCTGTGGTCGGGGG + Intronic
1184236753 22:43187144-43187166 CGGGGCGGGGCAGGGGGCGGAGG - Intergenic
1184337513 22:43862442-43862464 CGGGGCGCGGGCGCGGGCGCGGG - Exonic
953485001 3:43286689-43286711 CGGAGCGCGGCGGGGCGCGGCGG + Intronic
954303785 3:49714965-49714987 TGGAGAGCGGCAGTGGGGCCAGG + Intronic
954469036 3:50675493-50675515 GAGAGGGCGGCAGGGGGCGCTGG + Intronic
956459262 3:69454707-69454729 CTGAGCCCCGCAGTGGGCTCTGG + Intronic
961518879 3:127455717-127455739 CTGGGGGCGGCAGGGGGCGCTGG - Intergenic
961775281 3:129279513-129279535 CGGAGCTGGGCAGTGGGCTCAGG + Intronic
966182293 3:177197852-177197874 CGGCCCGCGGCGGTGGGGGCGGG - Intergenic
966579593 3:181545563-181545585 AGGATCGAGGCAATGGGCGCTGG - Intergenic
966808732 3:183825555-183825577 GGGAGCGGGGCGGCGGGCGCCGG - Exonic
968701078 4:2058704-2058726 CCGAGCCCCGCAGTGGGCACGGG - Intergenic
968737259 4:2303917-2303939 CTGTGCGGGGCAGTGGGAGCGGG - Intronic
968889954 4:3363632-3363654 TGGAGCCCTGCAGTGTGCGCCGG - Intronic
970967859 4:21948807-21948829 CGGAGGCCGGCGGGGGGCGCCGG + Intergenic
974747906 4:66100091-66100113 CTGGGCGCGGCGGCGGGCGCCGG + Intergenic
975395530 4:73869623-73869645 CTGAGCGAGGCTGTCGGCGCTGG - Intronic
981617313 4:146655242-146655264 CCGAGCGCAGCAGGGGGCGCAGG - Intergenic
981782931 4:148445740-148445762 CGCAGAGGGGCAGCGGGCGCGGG - Intergenic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984888662 4:184473285-184473307 CCGAGCGGCGCAGTGGGGGCCGG - Intronic
985899993 5:2780713-2780735 CGCAGCCCTGCAGTGGGCACAGG + Intergenic
987710533 5:21497268-21497290 GGGAGCACTGCAGTGGGCGCAGG - Intergenic
990557647 5:56951904-56951926 CGGGGGGCGGGAGCGGGCGCGGG - Intronic
990955320 5:61333343-61333365 CGGGGCGGGGGAGGGGGCGCGGG + Intronic
991760863 5:69916327-69916349 GGGAGCACTGCAGTGGGCGCAGG - Intergenic
991786467 5:70201774-70201796 GGGAGCACTGCAGTGGGCGCAGG + Intergenic
991840092 5:70791378-70791400 GGGAGCACTGCAGTGGGCGCAGG - Intergenic
991878910 5:71202159-71202181 GGGAGCACTGCAGTGGGCGCAGG + Intergenic
1000071412 5:157743982-157744004 CGGGGCGCGGCCGCGGGCTCTGG + Exonic
1001462134 5:171925084-171925106 CGGAGCGCGGCCCTGGGCAGGGG + Intronic
1002368152 5:178729368-178729390 CTGAGCGGTGCAGTGGGTGCTGG - Intronic
1002385173 5:178860680-178860702 CTGAGCGGTGCAGTGGGTGCTGG + Intronic
1004285562 6:14317767-14317789 CGGAGTGCTGCAGTGTGCCCGGG + Intergenic
1005547156 6:26883249-26883271 GGGAGCACTGCAGTGGGCGCAGG + Intergenic
1005825202 6:29628083-29628105 CGGCGCGCGGCAGCGGGGGGTGG + Intronic
1005940672 6:30557163-30557185 CGGAGGGAGGCAGTTGGCTCCGG + Exonic
1009431863 6:63573357-63573379 CGGAGCTCCGGGGTGGGCGCGGG + Intronic
1016714056 6:147203933-147203955 CGGGGCGAGGCAGGCGGCGCGGG + Intergenic
1018959920 6:168441059-168441081 GCGGGCGCGGCAGCGGGCGCTGG + Intergenic
1019284855 7:218366-218388 CGCAGCGCGGCACTGGACGGAGG - Intronic
1019440702 7:1044790-1044812 CGGAGCCCCGCAGTGGGCAGCGG - Intronic
1019521155 7:1461072-1461094 AGCAGCGGGGCAGTGGGCGGGGG + Intergenic
1019536136 7:1530814-1530836 GGGAGCGCGACAGTGAGCGCCGG + Exonic
1019563179 7:1667806-1667828 TGGAGCGCGGCGTTGGGCCCCGG + Intergenic
1019738048 7:2660100-2660122 GGGAGGGCGGCAGTGAGTGCAGG - Intronic
1020083751 7:5299604-5299626 CGGAGCGCCCCAGTGGGATCAGG - Intronic
1023863548 7:44228556-44228578 CGGGGAGTGGCAGTGGGAGCAGG + Intronic
1025207142 7:57000434-57000456 GGGAGGGCGGCAGTGGGAGACGG - Intergenic
1025664794 7:63576456-63576478 GGGAGGGCGGCAGTGGGAGACGG + Intergenic
1025926909 7:65967637-65967659 GGGAGCAGTGCAGTGGGCGCAGG + Intronic
1027121961 7:75528199-75528221 CGGAGACCAGCAGTGGGCCCTGG - Intergenic
1029168933 7:98617439-98617461 CTGAGCGCGGCAGCGGCGGCGGG + Exonic
1030215980 7:107044584-107044606 CGGTGCGCGGGAGGGGGCGCAGG - Intergenic
1032383530 7:131506358-131506380 CAGAGCGAGGCAGTGGGGGACGG + Intronic
1034977047 7:155454861-155454883 GGGAGCGCGGCAGCCGGGGCTGG + Intergenic
1035187565 7:157138633-157138655 GGGAGCGCGGCGAGGGGCGCGGG - Intergenic
1037918801 8:22789602-22789624 CAGAGCTCTGCAGTGGGCCCAGG - Intronic
1038268241 8:26052227-26052249 CGGGGTGCGGCAGTGGTGGCGGG + Intergenic
1039502780 8:38030511-38030533 CGGAGCGAGGCTGGAGGCGCGGG + Exonic
1041381629 8:57258989-57259011 CAGAGCTAGGTAGTGGGCGCTGG - Intergenic
1041489078 8:58411491-58411513 GGGAGCGCGGCGGTGGACGCGGG + Intronic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1042902852 8:73746415-73746437 AGGAACGCGGCTGCGGGCGCGGG - Intronic
1046962171 8:120123824-120123846 CGCAGGGCGGCGGTGGGGGCTGG + Intronic
1048879910 8:138863630-138863652 CGCAACGCGGAAGTGGGTGCGGG + Intronic
1049419555 8:142510786-142510808 GGGCGCGCGGCTGCGGGCGCAGG + Intronic
1049483642 8:142840007-142840029 GGAAGCGCGTCAGTGGGCGGAGG + Intronic
1049551108 8:143260357-143260379 CCTAGTGGGGCAGTGGGCGCGGG + Intronic
1049570171 8:143366218-143366240 AGGGGCACGGCAGTGAGCGCCGG - Intergenic
1049645341 8:143733532-143733554 TGGAGCGCGGCCGCGTGCGCGGG - Intronic
1049716279 8:144094682-144094704 GGCAGCCCGGCAGAGGGCGCGGG - Intergenic
1050884253 9:10743744-10743766 CCGGGCGTGGCGGTGGGCGCCGG + Intergenic
1057547024 9:96026415-96026437 CGGAGCGCCGCAGTGGGGCGGGG + Intergenic
1057573113 9:96219076-96219098 TGGAGCGCGGGAGTGGGGGTGGG - Intergenic
1057995640 9:99820053-99820075 CGGGGCGGGGCAGGGCGCGCGGG - Intergenic
1057997138 9:99828685-99828707 CTGAGCGCGGCAGCGGCCGTCGG - Exonic
1058176047 9:101737773-101737795 CGGAGCGCGGCTGGCCGCGCGGG + Exonic
1060813960 9:126625252-126625274 CGGAGCGTTGCCGTGGGGGCGGG + Intronic
1061365942 9:130172524-130172546 CGCTGCGCGGCTGTCGGCGCCGG - Intergenic
1062286002 9:135772757-135772779 CGCAGAGCGGCGGTGGGGGCGGG + Exonic
1062346771 9:136118610-136118632 GGGCGCGCGGCTGGGGGCGCTGG + Exonic
1062367309 9:136216985-136217007 CGGAGCGAGGCCGTGGGCGCAGG - Intronic
1062596587 9:137302438-137302460 CGCTTCGCGGCAGGGGGCGCTGG + Intergenic
1062678049 9:137759889-137759911 CTGAGCGGGTCAGTGGGGGCAGG + Intronic
1186301898 X:8208377-8208399 CTGAGCGTGGTAGCGGGCGCCGG + Intergenic
1186496487 X:10015680-10015702 GGGACCGCGGCGGGGGGCGCCGG - Exonic
1187120756 X:16403945-16403967 GGGAGGGTGGCAGTGGGGGCAGG + Intergenic
1187518265 X:19991296-19991318 GAGAGGGCGGCAGAGGGCGCAGG - Intergenic
1189542240 X:42004418-42004440 GGGAGCCAGACAGTGGGCGCAGG + Intergenic
1190688848 X:52897240-52897262 CGCAGCGCGGAAGGGGGCGCCGG - Intronic
1190697135 X:52958552-52958574 CGCAGCGCGGAAGGGGGCGCCGG + Intronic
1200121714 X:153794203-153794225 GGGACCGCGGCAGCGGTCGCAGG - Exonic