ID: 1122881340

View in Genome Browser
Species Human (GRCh38)
Location 14:104691803-104691825
Sequence CCTCCTAGGGTGAGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122881340_1122881351 20 Left 1122881340 14:104691803-104691825 CCTGCCAGCCTCACCCTAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 226
Right 1122881351 14:104691846-104691868 CTCTGAGCACCCAGACAGCCTGG 0: 1
1: 0
2: 0
3: 42
4: 307
1122881340_1122881352 21 Left 1122881340 14:104691803-104691825 CCTGCCAGCCTCACCCTAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 226
Right 1122881352 14:104691847-104691869 TCTGAGCACCCAGACAGCCTGGG 0: 1
1: 0
2: 2
3: 26
4: 223
1122881340_1122881347 -8 Left 1122881340 14:104691803-104691825 CCTGCCAGCCTCACCCTAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 226
Right 1122881347 14:104691818-104691840 CTAGGAGGGAGAGTCCTGCCTGG 0: 1
1: 0
2: 5
3: 35
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122881340 Original CRISPR CCTCCTAGGGTGAGGCTGGC AGG (reversed) Intronic
900591845 1:3463635-3463657 GCTCCGAGTATGAGGCTGGCTGG - Exonic
900889604 1:5440176-5440198 CTTCCCAGGGTGGGGATGGCAGG + Intergenic
901185770 1:7372129-7372151 CTTCCTGGGTTGAGGCTGCCAGG + Intronic
901462091 1:9398029-9398051 GGTCCAAGGGTGTGGCTGGCGGG - Intergenic
901794679 1:11673447-11673469 CCTCCCAGGGCCAGGATGGCAGG + Intronic
901917507 1:12511281-12511303 CCACCTAGGGCGGGGCTGGGTGG + Exonic
902289614 1:15427646-15427668 CCTCCTAGGCTGGGGCTGGTGGG - Intronic
902396688 1:16135746-16135768 CCCCCCAAGGTGAGGCTGGAGGG - Exonic
904609980 1:31720548-31720570 CCTCCCTGGGTGAGCCGGGCTGG + Intergenic
906536058 1:46551571-46551593 TCTCCTGGGTGGAGGCTGGCAGG - Intergenic
906701178 1:47859297-47859319 CCAGCCAGTGTGAGGCTGGCTGG - Intronic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG + Intronic
914278024 1:146142618-146142640 CCCCATAGGGGGAGGCAGGCGGG - Intronic
914539071 1:148593566-148593588 CCCCGTAGGGGGAGGCAGGCGGG - Intronic
915342115 1:155182232-155182254 CTTGCTAGGGTGGGGCTGGGAGG + Intronic
916071137 1:161170611-161170633 CCTCCTTAGGTGATGCTGGGAGG + Exonic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
919977407 1:202621712-202621734 CCTCTGAGGGTGAGGGGGGCAGG - Intronic
919999366 1:202785232-202785254 CCAGCTAGGGTTAGGCTGGAAGG - Intronic
920966450 1:210705222-210705244 CCTCCTCTGGAGAAGCTGGCAGG - Intronic
922337609 1:224630602-224630624 CCTCCTGGGGTAAGGGTGGGAGG + Intronic
1063139080 10:3240721-3240743 CCTCCCAGGATGAGGGAGGCAGG - Intergenic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1068291058 10:55001678-55001700 CTTCCAAGGGTGAGCCAGGCAGG - Intronic
1069631469 10:69899653-69899675 CCTCCTTGGGTTAGGAAGGCAGG - Intronic
1069744430 10:70706165-70706187 CATCCAAGGCTGATGCTGGCTGG + Intronic
1070814957 10:79317215-79317237 CCCCCTAAGGTGAGGCTGCGTGG - Intergenic
1072195790 10:93116296-93116318 CCTCTGAGGAAGAGGCTGGCAGG - Intergenic
1072296266 10:94012085-94012107 CGTCCCAGGGTGAGACTGCCTGG + Intronic
1072668146 10:97409443-97409465 CCTCCTAGGCTGAGGAAGACTGG + Intronic
1074319376 10:112387503-112387525 TTTCCTAGGTTGAGGGTGGCAGG + Intronic
1075104033 10:119525360-119525382 GCTCCTGGTGTGAGGCTGGAGGG - Intronic
1075705166 10:124496280-124496302 GATCGTAGGGTGAGCCTGGCCGG + Intronic
1076863738 10:133157072-133157094 CCCCGTGGGGTGAGCCTGGCAGG + Intergenic
1076880262 10:133236416-133236438 CCCTCAAGGGGGAGGCTGGCGGG - Intergenic
1076888167 10:133272003-133272025 CCTGGTGGGGTGAGGGTGGCAGG - Intronic
1077168787 11:1157211-1157233 CCAGGGAGGGTGAGGCTGGCTGG + Intergenic
1077468944 11:2747818-2747840 GCACGCAGGGTGAGGCTGGCTGG + Intronic
1078102242 11:8336791-8336813 CCTCCTGGGCTAAGGCTGGGCGG + Intergenic
1078759613 11:14241927-14241949 CCTCCTAGGCTCAGGCTCCCCGG - Intronic
1080700780 11:34642324-34642346 GCTCCCAGGGCGAGGCTGGCTGG - Intronic
1081885473 11:46492159-46492181 CCTCCTCAGATGAGGCTGTCAGG + Intronic
1082833697 11:57637909-57637931 CCGCCTTGGGTGAGGCTGAAAGG + Intergenic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083333869 11:61911887-61911909 CCTCCTAGGGTGGGCCTGGTGGG - Intronic
1083953334 11:65968901-65968923 CCTCATAGGGTGTTGCTGGGAGG - Intronic
1084410542 11:69003865-69003887 CCTTCTAGCGTGGCGCTGGCTGG + Intergenic
1084943477 11:72626567-72626589 AGTCCTGGGGTGAGGCTGGAGGG - Intronic
1085793475 11:79516312-79516334 CTTCCTAGGGTGAGGCAGAATGG + Intergenic
1089731285 11:120520648-120520670 CCTCCAAGGGCCTGGCTGGCTGG + Intronic
1090797340 11:130146435-130146457 CTGCCTAGGGTGAGGCCGCCTGG - Intergenic
1091230933 11:133987534-133987556 CCTCATCGGGAGAGGCTGGGTGG + Intergenic
1092503843 12:9074637-9074659 CCTCCGAGGTTGGGGCTGGCTGG + Exonic
1092981081 12:13794930-13794952 CCTCTCATGGTGAGGCTTGCTGG - Intronic
1094498970 12:31006575-31006597 CCTCCTAGGATGATCCTGTCTGG + Intergenic
1095573908 12:43712933-43712955 CCTCCAAGAGTGAGATTGGCAGG - Intergenic
1097144060 12:56927699-56927721 CCACCTAGGGTGAGGTCTGCTGG - Intronic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1104847252 12:131852739-131852761 CATCCCAGGATGAGGCTGCCAGG + Intergenic
1105038038 12:132940681-132940703 CCTGCCAGTCTGAGGCTGGCCGG - Intronic
1107016117 13:35708922-35708944 CCACCTCTGGTGAGGCTGCCAGG + Intergenic
1108478341 13:50843116-50843138 CCTCCAAGGGTGGGGCTGCTGGG - Intronic
1114199811 14:20509554-20509576 ACTCCTAAGCTGAGGCTGGAGGG - Intronic
1114620720 14:24094537-24094559 CATCCTAGGCGGAGGCGGGCAGG + Intronic
1115090698 14:29571103-29571125 TCTACTAGAGTGAGGCAGGCTGG + Intergenic
1115522030 14:34242539-34242561 CCACATAGGGTGATGCTGGCAGG - Intronic
1116589651 14:46755336-46755358 CCTCCAAGGGGCAGGCTGGAGGG + Intergenic
1117377412 14:55129184-55129206 CCGCCTCGGGAGAGGCGGGCCGG + Exonic
1119648010 14:76362495-76362517 GCTACCAGGATGAGGCTGGCAGG - Intronic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1122213152 14:100186141-100186163 CCTCCTGGGATGAGGCCAGCAGG + Intergenic
1122577349 14:102750745-102750767 TCTCCTGGGGAGAGGCTGGCTGG + Intergenic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1123014064 14:105365230-105365252 TCCCCTGGGGTGATGCTGGCCGG - Intronic
1124493066 15:30170085-30170107 CCTCTGAGGGTGAGGGGGGCAGG - Intergenic
1124651692 15:31478822-31478844 CCTCCTGGGGTGAGCGTGGGGGG + Exonic
1124750468 15:32368240-32368262 CCTCTGAGGGTGAGGGGGGCAGG + Intergenic
1126110128 15:45170067-45170089 CCTCCCAGGCTAAGGCAGGCTGG + Intronic
1127084005 15:55408095-55408117 CCTCCTAGGCTGGGGCTGCTCGG - Intronic
1128078421 15:64842127-64842149 CTTCCTGAGGTGAGACTGGCGGG - Intronic
1128113068 15:65088575-65088597 GTTCCCAGGGTGAGGCTGCCAGG - Intergenic
1129481608 15:75830943-75830965 GCTGCTAGGGTGATGCTGACGGG - Intergenic
1131520037 15:93107525-93107547 TCCCCTCGGGTGGGGCTGGCTGG + Intergenic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133845339 16:9448263-9448285 GATCCTAGGGTGAAGCTGGAGGG + Intergenic
1135207265 16:20493907-20493929 CCACCTTGGGAGAGGCTGGAAGG + Intergenic
1135211620 16:20529725-20529747 CCACCTTGGGAGAGGCTGGAAGG - Intergenic
1135406207 16:22199783-22199805 CCTTCAAGGGTGACGCTGCCAGG + Intergenic
1135991852 16:27223318-27223340 CCTCTTTAGGTGAGGCCGGCCGG + Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139325998 16:66152857-66152879 CCTCCCAGGGTCAGCCTTGCTGG - Intergenic
1141553592 16:84822113-84822135 CCTGTTGGGGTGAGGCTGGGAGG + Intronic
1142006445 16:87691596-87691618 CCTCTGGGGGTGGGGCTGGCAGG - Intronic
1143314011 17:6017661-6017683 TCTGCTAGGGTGAGGTTGGGAGG - Intronic
1143426444 17:6843018-6843040 CCAGCTGGGGTGAGGCTGGATGG + Intergenic
1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG + Intergenic
1144679644 17:17184402-17184424 CCTCCTCAGCTGAGGCTGTCAGG + Intronic
1144850717 17:18242620-18242642 TTTCCTGGGGTGAGGCTGGTGGG + Exonic
1146693004 17:34889585-34889607 GCTCCCAGGTTCAGGCTGGCAGG + Intergenic
1146937882 17:36823937-36823959 CCTCTCTGGCTGAGGCTGGCAGG - Intergenic
1147644392 17:42025147-42025169 CCTCCAAGAGCGAGGCTGGCGGG - Exonic
1151587521 17:75019241-75019263 CCTCCTAGGGGGAGACAGGCAGG + Intronic
1152687297 17:81700875-81700897 GGTCCTTTGGTGAGGCTGGCAGG + Intronic
1153746494 18:8185269-8185291 TCCTCTAGGGTAAGGCTGGCTGG + Intronic
1157535338 18:48453356-48453378 CCTCCAAGGAAGAGGCTGACAGG - Intergenic
1161194969 19:2981595-2981617 CCTCCTTGGTTGGGGCTGCCTGG - Intronic
1161249271 19:3271462-3271484 CCTCTGAGGGTGCGGCTGGGCGG + Intronic
1161380357 19:3961561-3961583 CCTCCCAGCGTCAGGCTGGGAGG - Intronic
1162312216 19:9914086-9914108 CCGCCTAGGGGGAGGGGGGCCGG - Intronic
1162745278 19:12794175-12794197 CCGCCTAGAGGGAGTCTGGCCGG + Intronic
1163370972 19:16901127-16901149 GCACCCAGGGTCAGGCTGGCTGG - Intronic
1163430327 19:17263431-17263453 CATCCCAGGGTGAGACTGGGAGG + Intronic
1163660163 19:18572107-18572129 CCTCGTGGGGTCACGCTGGCAGG - Intronic
1163726162 19:18924326-18924348 TATCCCAGGGTGAGGCTGGCGGG - Intronic
1164402229 19:27910160-27910182 CCTCCAAGGAGGACGCTGGCGGG + Intergenic
1165006920 19:32814872-32814894 CCTCCCATGGTGAGGGTGGGGGG - Intronic
1165313506 19:35041713-35041735 CCTCCTCAGGTGAGGCAGCCTGG + Exonic
1165595661 19:37009744-37009766 CCTCATCTGGTGAGGCAGGCAGG - Intronic
1166422969 19:42652826-42652848 CCTCCTAGGGTGCAGAGGGCAGG - Intronic
1166793785 19:45414076-45414098 CCTCCTAGGCTCAGTCTTGCTGG - Intronic
1166998514 19:46731328-46731350 CCTGCTTGCGCGAGGCTGGCTGG - Intronic
1168291159 19:55358392-55358414 CCTCCCACGGTGAGGCGGTCAGG + Exonic
1168452013 19:56474099-56474121 CCTCCTGAGGTGAGGACGGCTGG + Exonic
925001584 2:407071-407093 GCTCCTGGGGTGTGGCTGGAAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925663189 2:6224423-6224445 GCTCCTAGGGTGGGGCTGTGGGG + Intergenic
926404950 2:12541624-12541646 CATCCTAAGGTAAGGCTTGCAGG - Intergenic
933688497 2:85161516-85161538 CCTCCTGGGATGGGGATGGCTGG + Intronic
935699338 2:105797553-105797575 CGTCTTAGGGTCAGGATGGCTGG + Intronic
936403732 2:112184575-112184597 TCGCATGGGGTGAGGCTGGCAGG + Intronic
936857756 2:116980629-116980651 CCTGCTCTGGTGAAGCTGGCAGG - Intergenic
942804391 2:179912620-179912642 CCTCATAGTCTGTGGCTGGCTGG - Intergenic
944095386 2:195961399-195961421 CCTACAAGGGTGGGGCTGGTGGG - Intronic
944504654 2:200398150-200398172 CCTCCTGGGGGGAGTGTGGCTGG + Intronic
946591961 2:221259902-221259924 CCCACATGGGTGAGGCTGGCAGG + Intergenic
948788521 2:240365370-240365392 CATCCTGGGGTGGGCCTGGCGGG + Intergenic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1173960380 20:47066794-47066816 CCTCTTAAGGTGATGGTGGCAGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174518821 20:51114082-51114104 CTTACTAGAGTGAGGCAGGCAGG - Intergenic
1175408253 20:58749251-58749273 CCTCAAAGGGTGTGGGTGGCTGG + Intergenic
1176124974 20:63471352-63471374 CCTCCTGGGGCAGGGCTGGCGGG - Intronic
1177071390 21:16513054-16513076 CCTCATAGGGGCAGGCAGGCTGG + Intergenic
1179887194 21:44319206-44319228 GTTCCTAGGGAGAGGCTGCCAGG + Intronic
1180556520 22:16582443-16582465 CCTGCTAGGGACAGTCTGGCAGG + Intergenic
1181592366 22:23893354-23893376 CCTCCCAGCTGGAGGCTGGCTGG + Intronic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1181967777 22:26668674-26668696 GCTCCTCGGGTGCCGCTGGCTGG + Intergenic
1182301549 22:29340001-29340023 GCTGCTAGGGTGAGGCAGGAAGG - Intronic
1182548869 22:31090572-31090594 CATCCTAGGGTCAGTGTGGCAGG + Intronic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1183708670 22:39489911-39489933 CTTCCTTGGGGCAGGCTGGCTGG + Exonic
1183715774 22:39532673-39532695 CGTCCGAGGGTGAGGAGGGCTGG - Exonic
1184538224 22:45101933-45101955 CCTTCTAGGGTGAGGTGGGGGGG + Intergenic
1184979159 22:48084053-48084075 GCTCCTGGGCTGAGGCTGGAGGG - Intergenic
1185116129 22:48939460-48939482 CCGCCCTGGGAGAGGCTGGCAGG - Intergenic
1185164851 22:49255300-49255322 CCCCCGAGGCTGAGCCTGGCTGG - Intergenic
1185347756 22:50317834-50317856 CCTGCCAGGGTCAGGCTGGTAGG - Intronic
950501319 3:13365669-13365691 CTTCGTTGGGAGAGGCTGGCAGG + Intronic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
954375056 3:50189707-50189729 CCCCCTAAGCTGAGGCAGGCAGG + Intergenic
954447743 3:50555640-50555662 GCACCTAGGGTGAGGGGGGCAGG + Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
958692722 3:97488490-97488512 CCTGCTGGGTTGAGGGTGGCAGG - Intronic
961393471 3:126570295-126570317 CCTCCTGGGGTGAGGGGAGCTGG + Intergenic
966370272 3:179244431-179244453 CCTGCTAGGGACAGTCTGGCAGG + Intronic
968276819 3:197446553-197446575 GCTCAGAGGGTGAGCCTGGCCGG + Intergenic
968594490 4:1475284-1475306 CATCCTTAGGTGAGGCTGGTAGG - Intergenic
969405992 4:6992128-6992150 CCACTCAGGGTGAGGCAGGCGGG + Intronic
969721848 4:8896403-8896425 CCTCCTGAGGTCAGGCTGGAGGG - Intergenic
969882723 4:10188530-10188552 CCTCCCAGGGTCTGGCTGGCTGG + Intergenic
969987607 4:11227652-11227674 CCTCCAATGGTGACACTGGCTGG - Intergenic
973801337 4:54481787-54481809 CTTCCTAGTTTGAGACTGGCTGG + Intergenic
981259357 4:142701284-142701306 CCTACTGTGGAGAGGCTGGCAGG - Intronic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
983029551 4:162782786-162782808 CCTCCTTGGGTGAGGGGGGCGGG + Intergenic
984426765 4:179597385-179597407 CTTCCTGGGAGGAGGCTGGCTGG + Intergenic
984950691 4:185005354-185005376 GCTTCTAAGGAGAGGCTGGCTGG - Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986043838 5:4018896-4018918 CCTAGTAGGGTGTGACTGGCAGG - Intergenic
988485655 5:31666221-31666243 GCTCCAAGACTGAGGCTGGCTGG - Intronic
988636298 5:32988343-32988365 TCTCATAGGGTGAGGCAGGAAGG + Intergenic
996353977 5:122576774-122576796 CCTCCTGGGGTGAGGCCACCTGG - Intergenic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
1002419842 5:179139736-179139758 CCAGGTAGGGTGAGGCAGGCGGG + Intronic
1002661352 5:180792811-180792833 ACTTCCCGGGTGAGGCTGGCGGG + Exonic
1003152984 6:3568530-3568552 CCCCCTCGGGGGAGGCAGGCAGG + Intergenic
1006516780 6:34549829-34549851 CCTCCTGCAGTGAGGCCGGCTGG - Intronic
1008056710 6:46953081-46953103 ACTGAGAGGGTGAGGCTGGCAGG + Intronic
1010570097 6:77464663-77464685 CCTCCTAGGGTGGGAGTGGTAGG - Intergenic
1016393679 6:143600122-143600144 CCTCCAATGATGTGGCTGGCAGG - Intronic
1016908111 6:149171181-149171203 CCTCCTAGGGTGACTCTGCTGGG - Intergenic
1018116927 6:160595316-160595338 CGTCCTAGGGTGTGGTTGTCTGG + Intronic
1019378905 7:711475-711497 CCTCCGAGGGGCAGGCGGGCGGG + Exonic
1020224631 7:6271100-6271122 CCTCCTACAGTCAGGCTGTCTGG - Intronic
1022516545 7:30978304-30978326 CATCCCAGGCTGAGGCTGGTGGG + Intronic
1023820564 7:43978316-43978338 CTTCCTAGGGGGAAGCTGTCTGG - Intergenic
1023871649 7:44266549-44266571 CCCCCCAGAATGAGGCTGGCAGG - Intronic
1024293527 7:47824756-47824778 GCTCCTAGGGAGAGGCCTGCAGG - Intronic
1024453790 7:49579995-49580017 TCTCCTTGCCTGAGGCTGGCCGG - Intergenic
1029378829 7:100199405-100199427 CCCCCTAGGGTGAAACTGGGAGG + Intronic
1029652573 7:101903438-101903460 CCTACAAGGCTGAGCCTGGCAGG + Intronic
1029748843 7:102531759-102531781 CTTCCTAGGGGGAAGCTGTCTGG - Intergenic
1029766786 7:102630865-102630887 CTTCCTAGGGGGAAGCTGTCTGG - Intronic
1033302659 7:140200482-140200504 AGTCCTAGGGTGAGGCCAGCAGG + Intergenic
1034235984 7:149569897-149569919 CCCGCTAGGGAGTGGCTGGCGGG - Intergenic
1034535292 7:151722333-151722355 TTTCCTAAGGTGAGGTTGGCAGG - Intronic
1034882818 7:154775640-154775662 CATCCTAGGGTGAGTCTGCCGGG + Intronic
1037552428 8:19987671-19987693 CCTCCTAGGAAGGGGCTCGCAGG - Intergenic
1037760862 8:21740631-21740653 TCTCCTAGGGAGAGTCTGGGTGG - Intronic
1037805021 8:22054267-22054289 CCTCCATGGGTGGGGCGGGCGGG - Intronic
1037930528 8:22877628-22877650 GCCCCTGGGGTGAGGGTGGCTGG - Intronic
1038925849 8:32138530-32138552 GCTCCTAGGCTGTGACTGGCAGG + Intronic
1041450965 8:58006507-58006529 CCTCCTAGGGTAAAACTGGCTGG + Intronic
1044581135 8:93827469-93827491 CCTCCCAGGCTGAGCCTGGTAGG - Intergenic
1046215596 8:111141441-111141463 CCTACTGTGGTGAGGCTAGCTGG + Intergenic
1046283665 8:112067550-112067572 ACTCCTAGGGTGAGGGAAGCTGG - Intergenic
1048447195 8:134500164-134500186 CTTCCCAGGGTGAAGCTGCCTGG + Intronic
1048989133 8:139751068-139751090 CATCCTAGGGAATGGCTGGCTGG + Intronic
1049113810 8:140668286-140668308 ACTCCTCTGGTGGGGCTGGCTGG + Exonic
1049334719 8:142077259-142077281 TCTGGGAGGGTGAGGCTGGCTGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1050145115 9:2559532-2559554 CCTGCGATGGTGAGGCTTGCTGG - Intergenic
1051601350 9:18877927-18877949 TCTCCTTGGGTGGGGCTTGCTGG + Intronic
1053042768 9:34888904-34888926 CATTCTAGGGTGGGGCTGGGAGG + Intergenic
1054775456 9:69120852-69120874 CGGCTAAGGGTGAGGCTGGCGGG + Intergenic
1055597552 9:77880999-77881021 ACTCCTATGGTGAGCCTGGCAGG - Intronic
1057105415 9:92410493-92410515 CCCACCAGGGTGAGGATGGCAGG - Intronic
1057790168 9:98119277-98119299 CCTCCTAGGGGTCGGCCGGCCGG - Intergenic
1058606556 9:106729573-106729595 CCTCCCAGAGTGAGGCCTGCTGG - Intergenic
1059771945 9:117434885-117434907 CTGCCTTTGGTGAGGCTGGCAGG + Intergenic
1060468490 9:123929387-123929409 CCACCTAAGGTGTGGATGGCCGG - Intronic
1060482065 9:124022538-124022560 CCTCCTGTTGTGAGGCTGTCCGG - Intronic
1061498573 9:130989712-130989734 CCCCACAGGGTGAGGCTGCCGGG + Intergenic
1061797824 9:133098558-133098580 CCTCCCAGGGTCTGGCTGGCTGG - Exonic
1062265114 9:135683442-135683464 CAGCCAAGGGTCAGGCTGGCGGG - Intergenic
1062278848 9:135743110-135743132 CCTCCCAGGGACAGGCAGGCAGG + Intronic
1062353403 9:136150048-136150070 GCTTCCAGGGTGAGGGTGGCCGG - Intergenic
1189967695 X:46391500-46391522 CCTGCAAGGGTCAGGCTGGATGG - Intergenic
1192795637 X:74422225-74422247 TCTCCTAGGGTGCGGGTTGCGGG + Intronic
1197378898 X:125714114-125714136 ACTGGTGGGGTGAGGCTGGCTGG - Intergenic
1198432168 X:136578412-136578434 GCTCCTAGAGTCAGGCTGCCTGG + Intergenic
1199429233 X:147740309-147740331 CATTCAAGGGTGAGGATGGCAGG - Intergenic