ID: 1122882210

View in Genome Browser
Species Human (GRCh38)
Location 14:104695245-104695267
Sequence CACCTACCATGGCTGTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122882210_1122882216 -7 Left 1122882210 14:104695245-104695267 CCCAGCCACAGCCATGGTAGGTG 0: 1
1: 0
2: 1
3: 25
4: 222
Right 1122882216 14:104695261-104695283 GTAGGTGCTGGCAGGCCCTCAGG 0: 1
1: 0
2: 0
3: 22
4: 207
1122882210_1122882217 -1 Left 1122882210 14:104695245-104695267 CCCAGCCACAGCCATGGTAGGTG 0: 1
1: 0
2: 1
3: 25
4: 222
Right 1122882217 14:104695267-104695289 GCTGGCAGGCCCTCAGGCCCAGG 0: 1
1: 0
2: 6
3: 68
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122882210 Original CRISPR CACCTACCATGGCTGTGGCT GGG (reversed) Intronic
900910638 1:5594723-5594745 CACCTCACAGGGCTGTTGCTGGG - Intergenic
901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG + Intronic
901456084 1:9363605-9363627 CACAGGCCATGGCTGGGGCTGGG + Intronic
903260363 1:22128570-22128592 CACCACCCCTGGCTGGGGCTGGG - Intronic
904824263 1:33264390-33264412 CAGCTGCCATTGCTGTTGCTAGG - Intronic
907408238 1:54267141-54267163 CACCTCGAATGGCTGTGGTTGGG + Intronic
912460392 1:109827031-109827053 CAGCCACCACGGCTGTGCCTGGG - Intergenic
913670430 1:121093180-121093202 CACCTACCATTGCTCAGGCATGG + Exonic
914022197 1:143880621-143880643 CACCTACCATTGCTCAGGCAAGG + Intergenic
914660682 1:149788550-149788572 CACCTACCATTGCTCAGGCATGG + Exonic
915763239 1:158336528-158336550 CACCTGCCATTGCTGAGGCTTGG + Intergenic
916343149 1:163758774-163758796 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
917356533 1:174131673-174131695 CACCTCCCTTGGCTGTGGGCTGG + Intergenic
917682823 1:177385030-177385052 CACCTCCCTTGGCTGGGGATGGG + Intergenic
921017383 1:211204792-211204814 AACCTTCCTTGTCTGTGGCTAGG + Intergenic
922720930 1:227899998-227900020 CACCCACCTTGGCTGTGGGACGG + Intergenic
922799813 1:228360050-228360072 CGCCGACCATGGCTGTGCCCTGG - Intronic
1062973497 10:1666008-1666030 CACCTGGCAGGACTGTGGCTGGG - Intronic
1063762282 10:9093443-9093465 CACATAACATCGCTGTGCCTCGG - Intergenic
1063944648 10:11165105-11165127 GCCCTACCCTGGCTGTGGCTGGG - Intronic
1069778950 10:70942937-70942959 CACACAGCATAGCTGTGGCTGGG - Intergenic
1070530767 10:77335298-77335320 AACCTTCCTTGGCTGTGCCTAGG - Intronic
1070754294 10:78982075-78982097 CTCCCTGCATGGCTGTGGCTGGG - Intergenic
1071499851 10:86195604-86195626 CTCCTACCCTGGCTGGGGGTTGG + Intronic
1073464363 10:103685437-103685459 CACCTACCCTGGTTGTTGCAGGG + Intronic
1073538420 10:104298301-104298323 CACCCACCATGAGGGTGGCTTGG - Intronic
1073976769 10:109110875-109110897 CACATCCCATGGCTGAGGCTAGG + Intergenic
1075825984 10:125357354-125357376 CACACAGCATGGCTGTGGGTGGG - Intergenic
1076857538 10:133124672-133124694 CCCCTACCCTGGTTGGGGCTTGG + Intronic
1076932947 10:133545969-133545991 CACCTCCCTTGGCTGTGGGTGGG - Intronic
1077454874 11:2672478-2672500 CACATTCCATGGCAGTGCCTAGG + Intronic
1077484912 11:2834182-2834204 CACATGGCATGGCTGGGGCTGGG + Intronic
1079674447 11:23208175-23208197 CACCAACCATGGGTTAGGCTGGG + Intergenic
1081094950 11:38921135-38921157 CATCCACCATTGCTGAGGCTTGG - Intergenic
1081508499 11:43743360-43743382 CACCTTCAATAGCTGTGACTGGG - Intronic
1081992176 11:47343683-47343705 AAGCTACTGTGGCTGTGGCTGGG + Intronic
1083521775 11:63320338-63320360 CACCTCCCTTGGCTGGGGGTAGG - Intronic
1083666571 11:64278517-64278539 CACCTCGCAGGGCTGTGGCGAGG - Intronic
1083687558 11:64385650-64385672 CATCTCCCCTGGCTGGGGCTTGG + Intergenic
1084176065 11:67422979-67423001 AAACTACCAGGGCTGGGGCTTGG - Intronic
1084616477 11:70239761-70239783 AACCAACCTTGGCTTTGGCTTGG + Intergenic
1087267805 11:96079886-96079908 CACCCATTAAGGCTGTGGCTGGG + Intronic
1087475118 11:98624266-98624288 CTGCTAGCATTGCTGTGGCTGGG + Intergenic
1089119635 11:116124624-116124646 CACATACCAGGGCTGGGGCATGG - Intergenic
1089492057 11:118889967-118889989 CACCTACCTTGGCCGTGCCTGGG - Intronic
1089567096 11:119377653-119377675 CTCCTACCCTGGCTGCAGCTTGG + Intronic
1090765347 11:129871543-129871565 CCCCATCCATGGCTTTGGCTTGG - Intronic
1091472026 12:737088-737110 AACCAACCAAGGCTGTGTCTCGG + Intergenic
1094052765 12:26239016-26239038 CCCCAGCCCTGGCTGTGGCTTGG + Intronic
1094755411 12:33463038-33463060 CATCCACCATTGCTGAGGCTTGG + Intergenic
1095858276 12:46885951-46885973 CCCTTGACATGGCTGTGGCTGGG - Intergenic
1096616630 12:52836720-52836742 CACCTACCATGGGTCAGGCCGGG + Intergenic
1096821224 12:54236577-54236599 CACCAAGCATGCCTGTGGCAAGG - Exonic
1097153624 12:56996948-56996970 CACTTATCATGGCTGTGCATAGG - Intergenic
1098694613 12:73537403-73537425 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
1101310713 12:103575963-103575985 CAAAAACCATGGGTGTGGCTGGG - Intergenic
1101598285 12:106186863-106186885 CACATATCATTGCTGTAGCTCGG + Intergenic
1102016911 12:109654241-109654263 CAGCTCCTATGGCTGTGACTGGG - Intergenic
1103700594 12:122847027-122847049 CAGCTGCCCTGGCTGAGGCTGGG + Intronic
1104099851 12:125597030-125597052 CATGCACCATGGCTCTGGCTGGG + Intronic
1105619411 13:22052505-22052527 ATCCTCCCATGGCTCTGGCTTGG + Intergenic
1108549248 13:51526818-51526840 CATCCACCATTGCTGAGGCTTGG + Intergenic
1108880427 13:55107661-55107683 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
1109040368 13:57327531-57327553 CACCTAACATGGATGTGTTTTGG + Intergenic
1109189147 13:59304791-59304813 CAGCTACCATGGCCTAGGCTTGG - Intergenic
1111242036 13:85486730-85486752 CACCTACCATCTCTGTGCCAAGG + Intergenic
1111305601 13:86409497-86409519 CACCTCCCTTGGCTGGGGGTAGG - Intergenic
1111728217 13:92040189-92040211 CACATACCGTGGCCCTGGCTAGG - Intronic
1113591091 13:111501807-111501829 CACCCGCCATTGCTGAGGCTTGG - Intergenic
1116677145 14:47920303-47920325 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
1118314191 14:64715760-64715782 CACCTCCCAGGGCTGTGGCCTGG + Intronic
1120178053 14:81316190-81316212 CACCTGCCATTTCTGTTGCTTGG - Intronic
1121142343 14:91554714-91554736 CACCTCCCCTGGCTGGGGGTGGG - Intergenic
1122599883 14:102915917-102915939 CACCTAGCTTGGATGGGGCTGGG - Intergenic
1122882210 14:104695245-104695267 CACCTACCATGGCTGTGGCTGGG - Intronic
1126956140 15:53935728-53935750 CACCTATCTTGGCTGAGGGTGGG - Intergenic
1129133704 15:73526481-73526503 CACCCACCATGGCTGTTGTAGGG + Intronic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1131075689 15:89493684-89493706 CACTCACCGTGGCTGTGGTTAGG - Intronic
1131356034 15:91748040-91748062 CAACTTCCAGGGCTGTGGCTGGG + Intergenic
1131401277 15:92127434-92127456 CACTTAACCTGGCTGTGCCTCGG + Intronic
1132284975 15:100656438-100656460 CACCTGCCAGGGATGGGGCTGGG - Intergenic
1135844020 16:25901981-25902003 CATCTACCAGGTCTGTTGCTGGG + Intronic
1136047241 16:27624298-27624320 GACCTGACATGGCTGGGGCTGGG - Intronic
1139387207 16:66580277-66580299 CACCTCCCATATCTGTGCCTGGG + Intronic
1140104077 16:71943239-71943261 AAGATACAATGGCTGTGGCTGGG + Intronic
1140841089 16:78839731-78839753 CACCAACCAAGCCTGTGACTTGG - Intronic
1141148994 16:81551425-81551447 CATGTGCCATGTCTGTGGCTGGG - Intronic
1141517679 16:84557203-84557225 TACCTGCCCTGGCTGTGCCTGGG + Intergenic
1141686778 16:85574794-85574816 CTCCCACCCTGGCTGTAGCTGGG - Intergenic
1142916451 17:3142966-3142988 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
1145984138 17:29033048-29033070 CTCCTACCCAGGCTGTGGTTGGG + Intronic
1146673338 17:34756832-34756854 CACCTCCCCAGGCTGTGGGTGGG - Intergenic
1148857153 17:50585001-50585023 CACTTACCTGGGCTGGGGCTGGG + Intronic
1149242249 17:54663710-54663732 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
1149597466 17:57872790-57872812 CACCTGCCATGGCTGGGCCAGGG - Exonic
1150190577 17:63233447-63233469 CACCTCCCTTGGCTGGGGGTGGG + Intronic
1151251283 17:72837401-72837423 CACCTACCATGGCACTTGCTTGG - Intronic
1151470280 17:74313793-74313815 CACCTTGCAGGGCTGTGGCCAGG - Intronic
1152681481 17:81670577-81670599 CAACTCCCAGGGCTCTGGCTTGG - Intronic
1155117590 18:22784407-22784429 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
1155501092 18:26487772-26487794 CACCTAGCATGGCTATGGACTGG - Intronic
1161725669 19:5927157-5927179 CACATTCCATGTCTGTGGCTGGG + Intronic
1162918328 19:13885954-13885976 CACCTACCTCGGCTGGGCCTTGG + Exonic
1164432155 19:28197900-28197922 GACATACCATGGCTTTGGGTTGG - Intergenic
1164941999 19:32257866-32257888 CAACTGGCATGGATGTGGCTTGG - Intergenic
1166935401 19:46329451-46329473 CCTCTCCCATGGCTGGGGCTCGG + Exonic
1167499643 19:49837869-49837891 GACCTTCCAGGGCTGTGGATGGG + Intronic
1168467053 19:56611420-56611442 AACCTACCCTGTCTGTGCCTTGG + Intronic
925167970 2:1730575-1730597 CTCCTCCCCTGCCTGTGGCTGGG - Intronic
925739823 2:6995731-6995753 CGCCTACCCTGGCTGAGGGTGGG + Intronic
926223556 2:10951875-10951897 CACCTCCCATGTCTGAGCCTAGG - Intergenic
926774102 2:16405097-16405119 CACCTGCTCTGGCTGTGCCTGGG - Intergenic
928757660 2:34545881-34545903 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
929229233 2:39541971-39541993 CACTTACTATGGACGTGGCTTGG + Intergenic
930946545 2:57083645-57083667 CACCTTCCATGGCTGGCACTGGG + Intergenic
932004689 2:67916321-67916343 CTCCTTCCTTGGCCGTGGCTGGG - Intergenic
933187252 2:79291747-79291769 CTCCTCCCATGGCAGTGACTTGG + Intronic
933906028 2:86893360-86893382 CACCTACCATAACTGGAGCTGGG - Intergenic
936073936 2:109389856-109389878 CACCTGCCTGGGCTGTGGCTGGG + Intronic
938729539 2:134135778-134135800 CACCACCCATGGCTGTGGCTCGG - Intronic
939638730 2:144613614-144613636 CACCTTACAGGGTTGTGGCTTGG + Intergenic
940240942 2:151562555-151562577 CAGCTTCCATGACTGTGTCTTGG - Intronic
940410656 2:153360201-153360223 CACCTCCCTTGGCTGGGGGTTGG - Intergenic
940615798 2:156047592-156047614 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
942761541 2:179404330-179404352 CACCTGGCATGGCTGCGGGTGGG - Intergenic
943964166 2:194310239-194310261 TTCCTACCAGGGCTGTGGCCTGG + Intergenic
944834273 2:203562775-203562797 GACCAACCATGGCTGTGACAGGG + Intergenic
945187397 2:207153491-207153513 CACTTACCATGGCTGTGTCATGG + Intronic
948248603 2:236507220-236507242 CCCACTCCATGGCTGTGGCTGGG + Intronic
1169720300 20:8668660-8668682 CTCCAACAATGGCTGTGGTTGGG - Intronic
1172272166 20:33660716-33660738 CACCCAGCCTAGCTGTGGCTGGG - Intronic
1174048010 20:47747673-47747695 CACCCACCAGGCCTGTGGCTGGG - Intronic
1174310257 20:49647576-49647598 CACATATCATAGCTGTGGTTAGG + Intronic
1175800088 20:61796552-61796574 CCCCGACCATTGCTCTGGCTTGG + Intronic
1181015117 22:20064181-20064203 AACCAAGCATGGCTGTGTCTGGG + Intronic
1181038582 22:20181532-20181554 CACCTGCCATGGGGGAGGCTGGG + Intergenic
1182197051 22:28529364-28529386 CGCCCACCATTGCTGAGGCTTGG + Intronic
1183104813 22:35608252-35608274 CACCAGCCAGGGCTGTGGTTGGG - Intronic
1183738430 22:39656746-39656768 CACCTAGCAAGGATGTGGCAGGG - Intronic
1183913654 22:41098850-41098872 CACCTTACAGGGCTGTGGTTAGG - Intronic
1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG + Intergenic
949947938 3:9204765-9204787 CTCCTACGAAGGCTGGGGCTGGG - Intronic
950183939 3:10933672-10933694 CTCCTGCCATGAGTGTGGCTTGG + Intronic
951988045 3:28642908-28642930 CACTTACTATGGGAGTGGCTTGG - Intergenic
955198384 3:56827504-56827526 CACCTTGCATGGCTGTTGCGAGG + Intronic
956374826 3:68603297-68603319 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
957696896 3:83650380-83650402 CACCTCCCTTGGCTGGGGATGGG + Intergenic
960398665 3:117169106-117169128 AACCTTCCCTGGCTGTGCCTCGG - Intergenic
962895312 3:139708682-139708704 CTCCCACCCAGGCTGTGGCTGGG + Intergenic
963605836 3:147411024-147411046 CCCCTTCCCTGGCTGTGGCAAGG + Exonic
964295241 3:155225817-155225839 CACCTCCCTTGGCTGAGGGTGGG + Intergenic
964857092 3:161158295-161158317 CACCTTCCATGGCTTTGGAGAGG - Intronic
965608039 3:170515992-170516014 CACCTAGCATGGCTGTAGGAGGG - Intronic
966207476 3:177419929-177419951 CACCTCCCACGGCAGTAGCTTGG + Intergenic
966531814 3:180989593-180989615 CACTCACCATGGCTCCGGCTGGG + Exonic
966945269 3:184773381-184773403 CACCTTCTCGGGCTGTGGCTGGG + Intergenic
967407532 3:189134201-189134223 CACCTGCCATCTCTGGGGCTTGG + Intronic
969582474 4:8073194-8073216 CCCCTACCACGCCTGTGCCTGGG - Intronic
970164909 4:13226427-13226449 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
970514886 4:16818615-16818637 CACCTACCAGGGCTATGGTGAGG + Intronic
970643250 4:18090677-18090699 CACCTGCCATTGCTGAGGCTCGG + Intergenic
971918678 4:32909397-32909419 CACCTCCCCTGGCTGTGGGTGGG - Intergenic
973263979 4:48192845-48192867 CTCCTACCAAGGCTGCTGCTTGG + Intronic
975150160 4:71012224-71012246 CGCCCACCATTGCTGAGGCTTGG + Intronic
977039743 4:92001701-92001723 CACCTCCCTTGGCTGGGGGTAGG - Intergenic
977343681 4:95791824-95791846 CACCCACCAATGCTGAGGCTTGG + Intergenic
978103731 4:104875808-104875830 CACCTACTATGTCTCTGGCATGG + Intergenic
978106017 4:104902580-104902602 CACTTTCCATTGCTGTGGCATGG - Intergenic
978501103 4:109410722-109410744 CACCTCACCTGGCTGTGACTTGG + Intergenic
980745099 4:137001989-137002011 CACCTTCCATGGCTGGCACTGGG - Intergenic
982636568 4:157904516-157904538 AATTTTCCATGGCTGTGGCTTGG - Intergenic
983957518 4:173715593-173715615 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
984278732 4:177641071-177641093 CTACAACCATGGCTGAGGCTGGG + Intergenic
986140499 5:5025645-5025667 CACCTCCCTTGGCTGTGGGGAGG - Intergenic
986430766 5:7679136-7679158 CACCTAGCCTAGCTGTGGGTGGG + Intronic
986492348 5:8306252-8306274 CACCTCCCTTGGCTGGGGGTAGG - Intergenic
987245043 5:16040289-16040311 CATCCACCATGACTGTAGCTAGG + Intergenic
988381268 5:30499534-30499556 CATCTGCCATTGCTGAGGCTTGG - Intergenic
989348306 5:40454127-40454149 CACCTCCCTTGGCTGGGGGTTGG + Intergenic
990570655 5:57075169-57075191 CTGCTTCCAAGGCTGTGGCTTGG + Intergenic
994350624 5:98742297-98742319 CACCTCCCTTGGCTGGGGGTGGG - Intergenic
996112104 5:119577790-119577812 CACGTACAGTGGCTGTTGCTGGG + Intronic
997627246 5:135339425-135339447 CACCTTCCAGGGCTGGGGCCAGG + Intronic
1001437951 5:171715098-171715120 CAACTAAGAGGGCTGTGGCTTGG + Intergenic
1001855861 5:175010041-175010063 CATTTACCAGGGCTCTGGCTTGG + Intergenic
1003263472 6:4546389-4546411 CCACTGCCATGGCTGTGTCTGGG + Intergenic
1006831394 6:36970354-36970376 TACCTACCAAGGCTGTGGGGTGG - Intronic
1007246582 6:40467695-40467717 AACCTCCCATGGCCGAGGCTAGG - Intronic
1010597046 6:77776665-77776687 GACTTAACATGGCTCTGGCTTGG - Intronic
1011296800 6:85835053-85835075 CACCCACCATTGCTGAGGCTTGG - Intergenic
1012731855 6:102893235-102893257 CACCAACCAGGGCTGGGGGTGGG - Intergenic
1013386347 6:109635565-109635587 CCGCTACCTTGGCTGTGTCTGGG - Intronic
1013417011 6:109934243-109934265 GAGCTACCATAGCTGTGGCAGGG - Intergenic
1014783234 6:125588354-125588376 CAGGCACCATGGCTGTGACTCGG - Intergenic
1017485545 6:154898785-154898807 CACCACCCAGGGCTGTGGGTAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018226197 6:161631068-161631090 CCTCTTCCATGGCTGTGGCTGGG - Intronic
1021130039 7:16900407-16900429 CACCTCCCCTGGCTGAGGGTGGG + Intergenic
1024121872 7:46250302-46250324 CACCTAGCATGGGTGAGGCCCGG + Intergenic
1024548111 7:50539152-50539174 CACTCACCTTGTCTGTGGCTTGG - Intronic
1024738228 7:52328500-52328522 CGCCTACCATTGCTGAGGCTTGG - Intergenic
1025756697 7:64351242-64351264 CATCTACAATGGCAGTTGCTGGG + Exonic
1026098485 7:67365543-67365565 CACCTGCCAGGGCTTTGGCCTGG - Intergenic
1026977051 7:74505403-74505425 CACCCACCTGGGCTGTGGCTCGG + Intronic
1028048826 7:86158057-86158079 CACCTCCCTTGGCTGAGGTTTGG - Intergenic
1028903792 7:96130885-96130907 CACCTACCCTGGCTGCAGCCTGG - Intronic
1029460363 7:100690878-100690900 CACCCATCCTGGCTGTGTCTTGG + Intergenic
1030220163 7:107090160-107090182 CCCCTACCCTTGCTGTGACTTGG - Intronic
1032422388 7:131793037-131793059 GAACAACCATGGCTGTGGCTGGG - Intergenic
1033484535 7:141775624-141775646 CACCCACCATTGCCGAGGCTTGG - Intronic
1033868315 7:145718874-145718896 CACCTCCCTTGGCTGGGGATGGG + Intergenic
1035049271 7:155989272-155989294 CACCCACCCTGGCCGAGGCTTGG + Intergenic
1037249647 8:16877393-16877415 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
1038088466 8:24226970-24226992 CACTTAACATTGCTGTGGCTTGG + Intergenic
1038531184 8:28319109-28319131 CACCTCACAGGGCTGTTGCTGGG - Intronic
1038706808 8:29901841-29901863 CACCTCCCTTGGCTGTGGGGAGG - Intergenic
1039897588 8:41727160-41727182 CACCTACCTGGGATGTGGCTTGG - Intronic
1043730133 8:83667645-83667667 CACCTGCCATGCCTGTTGCCAGG - Intergenic
1046339765 8:112838149-112838171 CACCTTCCTTGGCAGTGTCTGGG - Intronic
1046630070 8:116615077-116615099 CACCTACGATGTCTGTGTCGAGG - Intergenic
1046870124 8:119196862-119196884 CTCCAACCATGGCAGTGTCTGGG + Intronic
1049275349 8:141717522-141717544 CACCAGCCATGGGTGTGGGTTGG - Intergenic
1049604967 8:143525140-143525162 CAAGTGCCATGGCTGTGTCTGGG - Intronic
1056665984 9:88581201-88581223 CTCCTTCCAAGGCAGTGGCTGGG - Intronic
1056896078 9:90551893-90551915 CACGAATCTTGGCTGTGGCTGGG - Intergenic
1057564276 9:96154188-96154210 CACCTCCCTTGGTGGTGGCTGGG - Intergenic
1058101012 9:100917653-100917675 CTCCTCCCAGGGCTGTGTCTGGG + Intergenic
1059395083 9:114029025-114029047 CACCTGCCACAGCTGTGCCTGGG + Intronic
1060205754 9:121681928-121681950 CACCTACCATGGGTCAGACTTGG - Intronic
1061804207 9:133129061-133129083 CAACTCCCATGCCTGGGGCTCGG + Intronic
1061805940 9:133137873-133137895 CACCAGCCACGGCTGTGCCTTGG - Intronic
1061893479 9:133634912-133634934 CACCTGCCTGGGCTGTGGGTGGG + Intergenic
1062376552 9:136264354-136264376 CACGCAGCCTGGCTGTGGCTGGG + Intergenic
1186402096 X:9269496-9269518 CACCGCCCATGGCCGTGCCTGGG - Intergenic
1186646022 X:11508077-11508099 TACCTAGCATGGATGTGGGTAGG + Intronic
1186821627 X:13293978-13294000 CACCCACCATGGCTGCTTCTTGG + Intergenic
1187646007 X:21348211-21348233 CACATCCCTTGGCTGTGGGTAGG - Intergenic
1187777253 X:22775205-22775227 CACCTACCATACCGGTAGCTGGG - Intergenic
1187821182 X:23290118-23290140 CACCTACCATTGCTGAGGTTAGG + Intergenic
1188104471 X:26133028-26133050 CACTCACCAGGGCTGGGGCTAGG + Intergenic
1189247699 X:39576308-39576330 CCCCTGCCATGCCTGTGCCTAGG + Intergenic
1191113930 X:56832403-56832425 CATCCACCATGGCTGAGGCTTGG - Intergenic
1191209823 X:57872617-57872639 CACTTCCCTTGGCTGTGGGTAGG + Intergenic
1194264089 X:91734081-91734103 CACCTCCCTTGGCTGGGGTTGGG + Intergenic
1197424104 X:126273441-126273463 CACCTCCCTTGGCTGGGGGTGGG + Intergenic
1197775127 X:130113894-130113916 TACCTCCCAAGGCTGTGGCAAGG + Intergenic
1200742091 Y:6864648-6864670 CACCTCCCTTGGCTGTGGGGTGG + Intergenic
1202143259 Y:21751311-21751333 TACCTACCTTGGCTCTGGATGGG + Intergenic