ID: 1122882716

View in Genome Browser
Species Human (GRCh38)
Location 14:104697224-104697246
Sequence GGCCTTCCACAGCACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 184}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122882716_1122882720 -3 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882720 14:104697244-104697266 GCCCTCCTCGCCTGGCTCCTGGG 0: 1
1: 0
2: 0
3: 30
4: 325
1122882716_1122882732 25 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882732 14:104697272-104697294 AGTGAGGGAGCCGAGGCCTGGGG 0: 1
1: 0
2: 1
3: 54
4: 498
1122882716_1122882719 -4 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882719 14:104697243-104697265 GGCCCTCCTCGCCTGGCTCCTGG 0: 1
1: 0
2: 1
3: 45
4: 361
1122882716_1122882730 23 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882730 14:104697270-104697292 CAAGTGAGGGAGCCGAGGCCTGG 0: 1
1: 0
2: 5
3: 41
4: 400
1122882716_1122882729 18 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882729 14:104697265-104697287 GGAGGCAAGTGAGGGAGCCGAGG 0: 1
1: 0
2: 13
3: 58
4: 491
1122882716_1122882726 9 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882726 14:104697256-104697278 TGGCTCCTGGGAGGCAAGTGAGG 0: 1
1: 0
2: 7
3: 69
4: 397
1122882716_1122882727 10 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882727 14:104697257-104697279 GGCTCCTGGGAGGCAAGTGAGGG 0: 1
1: 0
2: 6
3: 71
4: 410
1122882716_1122882731 24 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882731 14:104697271-104697293 AAGTGAGGGAGCCGAGGCCTGGG 0: 1
1: 0
2: 2
3: 20
4: 324
1122882716_1122882723 0 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882723 14:104697247-104697269 CTCCTCGCCTGGCTCCTGGGAGG 0: 1
1: 0
2: 1
3: 33
4: 327
1122882716_1122882733 26 Left 1122882716 14:104697224-104697246 CCCACACTGTGCTGTGGAAGGCC 0: 1
1: 0
2: 2
3: 15
4: 184
Right 1122882733 14:104697273-104697295 GTGAGGGAGCCGAGGCCTGGGGG 0: 1
1: 0
2: 14
3: 74
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122882716 Original CRISPR GGCCTTCCACAGCACAGTGT GGG (reversed) Intronic
900406698 1:2495970-2495992 GGCCTTCCTCAGCACTGTCTGGG + Intronic
901574413 1:10189393-10189415 GGCCTCCCAAAGCAAAGTGCTGG - Intergenic
902631517 1:17707297-17707319 GTCCTCACACAGCAAAGTGTTGG - Intergenic
903674614 1:25056037-25056059 TCCCTTCCCCAGCACAGTGGAGG - Intergenic
904675698 1:32198043-32198065 CGCCTTGCACAGCACAGAGGTGG + Exonic
905232517 1:36523097-36523119 GGCCTTCCACCGCACGTTCTGGG + Intergenic
907321977 1:53608750-53608772 GGCCTTCCACAGCCCACCCTGGG - Intronic
912471253 1:109908521-109908543 GGCCATGCACAACACAGAGTAGG - Intergenic
912873461 1:113331042-113331064 GGCCTTCCAAAGCCAAGTGCCGG - Intergenic
913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG + Intergenic
915783810 1:158584858-158584880 GGCTTTCCACATCCCAGTCTGGG - Intergenic
918212399 1:182362707-182362729 GGCCTTCCAGAGGACAGGATAGG - Intergenic
920626718 1:207609626-207609648 GGTCTGGCACTGCACAGTGTGGG - Exonic
921339516 1:214120764-214120786 GGCCTCCCACTGCACACTGGTGG + Intergenic
922565144 1:226596817-226596839 GGCCCCGCACAGCACAGTGAAGG - Exonic
923232192 1:231997515-231997537 GGCCTTCCTCAGCAATGTGAAGG - Intronic
1066101639 10:32123007-32123029 GGCCTCCCACTCCACAGAGTAGG - Intergenic
1066613655 10:37275765-37275787 GGCCTCCCACAGTGCAGTGGTGG + Intronic
1070393851 10:75994476-75994498 GGCTTTGCTTAGCACAGTGTAGG + Intronic
1075639532 10:124054997-124055019 GGCCCTCCTCAGCACAGCCTGGG + Intronic
1076156976 10:128211844-128211866 GGCCTTCCACAGTCCCGTTTAGG + Intergenic
1076753451 10:132555251-132555273 GCCCTTCCCCAGCACGGTGAAGG - Intronic
1077642598 11:3895047-3895069 GGCCTTCCTTAGAACAGGGTCGG - Intronic
1078387312 11:10903848-10903870 GGGCTTCTACATCACAGTGATGG + Intergenic
1078891274 11:15560843-15560865 GGGCCTCCACAGCGCAGTGGCGG - Intergenic
1082083631 11:48031424-48031446 GGCCTTCCACAGCACCAACTTGG - Intronic
1083734097 11:64669858-64669880 GGCCTGCAGAAGCACAGTGTTGG - Intronic
1084240753 11:67818057-67818079 GGGCTCCCACAGTACAGTGGTGG + Intergenic
1086544690 11:87954032-87954054 AGCATTCCACAGCACACTTTAGG - Intergenic
1089386780 11:118073698-118073720 CGCCTTGCACAGCACAGAGGCGG - Intergenic
1089744702 11:120608633-120608655 TGCCTTTCAAAGCACTGTGTAGG + Intronic
1092502232 12:9059932-9059954 GGCCTCCCAAACCAAAGTGTTGG + Intergenic
1093535151 12:20214366-20214388 ATCCTTCCACAGCTCACTGTTGG - Intergenic
1093910400 12:24740848-24740870 GTGGTTCCACAGCACTGTGTCGG - Intergenic
1094258349 12:28462848-28462870 GGCTTTCTACATCACAATGTGGG - Intronic
1095801846 12:46277057-46277079 GGCCTCCAACAGCTCACTGTGGG + Intergenic
1096071056 12:48775772-48775794 GGACACCCTCAGCACAGTGTTGG - Intronic
1097077431 12:56405776-56405798 GGCCTTACACAGCTCATAGTAGG - Intergenic
1097602040 12:61705188-61705210 GACCTTCAACAGAGCAGTGTTGG - Intergenic
1098904498 12:76147975-76147997 TGCCTTCCACAACACAGATTTGG - Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1107991025 13:45819393-45819415 GGCCTTGGGCTGCACAGTGTTGG + Intronic
1113024709 13:105928191-105928213 GTCCTTCCACAGCAGAGTGTGGG + Intergenic
1115285933 14:31712574-31712596 GGGCCCCCACAGCACAGTGGCGG + Intronic
1116154685 14:41188033-41188055 GGCCTCAACCAGCACAGTGTAGG - Intergenic
1116265211 14:42679577-42679599 AGCCTTCCACAGTGCTGTGTAGG + Intergenic
1116623949 14:47242363-47242385 GGGCTCCCACAGTACAGTGGGGG - Intronic
1119084816 14:71730111-71730133 GGCCTTGCACAGAACACTGTCGG + Exonic
1119147269 14:72328691-72328713 GGCCTTCCAGAGGACTCTGTTGG - Intronic
1119284645 14:73443114-73443136 GGCCTCCCAAAGCACTGTGCTGG + Intronic
1121326361 14:93022166-93022188 GGCCTTCCAGCACCCAGTGTTGG - Intronic
1122882716 14:104697224-104697246 GGCCTTCCACAGCACAGTGTGGG - Intronic
1124151212 15:27180075-27180097 GGCCTTCCCCAGGAGACTGTGGG + Intronic
1124812270 15:32952998-32953020 GGAGTTCCCCAGTACAGTGTGGG - Intronic
1125503152 15:40252085-40252107 GGGCTACCCCAGCACAGTCTTGG + Exonic
1127316291 15:57797252-57797274 GGCCTGCCAAACCACAGAGTGGG - Intergenic
1127845447 15:62866508-62866530 GTCCTTCCCCAGGAGAGTGTGGG - Intergenic
1128468864 15:67935282-67935304 GGCCTCCCACAGAACAGAGTTGG - Intergenic
1128656726 15:69468041-69468063 CTCCTTCCCCAGCACAATGTCGG - Intergenic
1131012764 15:89032094-89032116 GGGCTCCCACAGCGCAGTGGCGG + Intergenic
1131405002 15:92157152-92157174 TACCTTCCTCAGCACAGGGTGGG + Intronic
1131543938 15:93299839-93299861 GGCCTTACGCATCACAGGGTGGG - Intergenic
1134230357 16:12424221-12424243 GCCCTTCAAGAGCAGAGTGTGGG + Intronic
1134241386 16:12509443-12509465 GGAATTCCACAGCTCAGTCTTGG + Intronic
1134797699 16:17056899-17056921 GGCCTACCTCAGCACTATGTTGG - Intergenic
1135470262 16:22723382-22723404 GGGCCTCCACAGCGCAGTGGTGG + Intergenic
1138013988 16:53412743-53412765 GGGCCCCCACAGCACAGTGGCGG - Intergenic
1138143962 16:54592147-54592169 GTCCTTCAACAGAACAGCGTGGG - Intergenic
1138796447 16:59975345-59975367 GTACTTCCTCAGCACAGTGGAGG + Intergenic
1139437501 16:66944844-66944866 GCCCATCCACAGCTCAGTGGGGG - Exonic
1140073669 16:71676198-71676220 GGCATTCCACAGAATAGTGGTGG - Intronic
1140825120 16:78699200-78699222 GGCCTTCCAAAGCAGAGGTTGGG - Intronic
1140976915 16:80068649-80068671 GGCATTCACCAGCACAGGGTTGG + Intergenic
1143502758 17:7348565-7348587 GGCCTTCCGCTGGACAATGTCGG + Intronic
1143708808 17:8719033-8719055 AGCCTCCCACACCACACTGTGGG + Intergenic
1146158865 17:30548296-30548318 GGAGCACCACAGCACAGTGTGGG + Intergenic
1146727808 17:35170147-35170169 GGCCCTCCACTGCCCAGCGTCGG - Exonic
1147154476 17:38536729-38536751 GGCTTTCCCCAGCCCAGAGTGGG + Intronic
1150792184 17:68207777-68207799 GGGCTCCCACAGTACAGTGGCGG - Intergenic
1151615771 17:75210014-75210036 GGCTTTCCACAGTGTAGTGTGGG - Intronic
1152041727 17:77907896-77907918 GGCCTGCCACCCCACAGTGATGG - Intergenic
1152201269 17:78947819-78947841 GGCCTCCCACAGCCCAGAGGAGG - Intergenic
1152897472 17:82921023-82921045 GGGCTGCCAGAGCACAGTGAAGG + Intronic
1159656173 18:71031779-71031801 GGGCTTCCACAGTGCAGTGGGGG + Intergenic
1160980941 19:1816324-1816346 GGTCATCCACAGCACCGTGGTGG - Exonic
1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG + Intronic
1163815923 19:19464434-19464456 GGCATTCCACAGCAGGGTCTGGG - Intronic
1164531750 19:29053814-29053836 GCCCTTCCAGGGCACAGTGCTGG - Intergenic
1164845600 19:31430043-31430065 GGCCTTCCTCAACACAGAGTAGG + Intergenic
1166201399 19:41239882-41239904 GGCCTAGCATAGCACATTGTAGG + Intronic
1166849632 19:45753321-45753343 CGCCTTCCTCAACACAGTGAGGG - Intronic
1168293069 19:55366366-55366388 GGGCTTCCAGAGCTGAGTGTGGG + Intronic
926108306 2:10166247-10166269 GGCCTTCCAGAGCTGAGTGCGGG + Intronic
927515360 2:23668900-23668922 GGGCCTCCACAGCAGAGTGTGGG + Intronic
929205183 2:39283702-39283724 GGCATTCTTCAGCATAGTGTGGG - Intronic
931432509 2:62219527-62219549 GGCCTACCAAAGCAAAGTGCTGG + Intronic
933415764 2:81985095-81985117 GGCCTCCCACAGTGCAGTGGCGG - Intergenic
933474066 2:82766450-82766472 GGCCTGCCCCAGCACTGTGTTGG + Intergenic
933767145 2:85717871-85717893 TGCTGTCGACAGCACAGTGTTGG + Intergenic
933998289 2:87686025-87686047 GCCCTGCCACCACACAGTGTTGG + Intergenic
936295560 2:111264848-111264870 GCCCTGCCACCACACAGTGTTGG - Intergenic
936606094 2:113955997-113956019 GGCCTCCCAAAGCAAAGTGTTGG + Intronic
939236818 2:139504641-139504663 GTTCTTCCAAAGTACAGTGTTGG - Intergenic
939813463 2:146864975-146864997 GACAATCCACAGCACAGAGTAGG + Intergenic
940024817 2:149194767-149194789 AGCTTCCCAGAGCACAGTGTAGG + Intronic
940650871 2:156439326-156439348 GGCCTCCCAAAGCAAAGTGCTGG - Intronic
944871698 2:203918562-203918584 GGCATCCCACAGCACAGAGGAGG + Intergenic
945661456 2:212690804-212690826 GGCCTCCCAGAGCACAGAGCAGG - Intergenic
946403594 2:219481421-219481443 GGGCTTCCTCATCAAAGTGTTGG + Exonic
947539421 2:230964695-230964717 GGCCTCCCGCTGCACTGTGTGGG - Intergenic
948168518 2:235881665-235881687 GGCCTGCCCAAGCTCAGTGTTGG + Intronic
948604653 2:239127085-239127107 AGCCTTCCTCAGCACACTGGTGG - Intronic
1169195697 20:3681078-3681100 TGGCTTCCACAGCACTGTGTGGG - Intronic
1170095081 20:12637263-12637285 GGACTTCCAGAGCACAGATTTGG - Intergenic
1171318915 20:24221161-24221183 GGGCTTCCACAGTGCAGTGGTGG + Intergenic
1174042225 20:47708220-47708242 GGCCTCTCACAGCACTGCGTGGG - Intronic
1176201922 20:63864964-63864986 GGCTTTCCACAGCGCCATGTTGG + Intergenic
1178442071 21:32606436-32606458 GGAGTTCCACAGCAAAGTGTGGG + Intronic
1179551603 21:42147035-42147057 GGGCCTCCTCCGCACAGTGTCGG + Intergenic
1179941537 21:44641820-44641842 AGCCTGCCACAGCAGAGTCTAGG - Intronic
1180211118 21:46295909-46295931 GCCCCTCCCCAGCACAGTGCTGG + Intronic
1182950759 22:34373593-34373615 GGCCTACCATAGCACAGAGCTGG - Intergenic
1183390265 22:37541722-37541744 ACCCTTGCACAGCACAGTGAGGG - Intergenic
1183516612 22:38270564-38270586 GGGCTGCCCCAGCACAGTGCAGG + Intronic
1184342650 22:43894411-43894433 GGCCATCCACAGGACAGTTGTGG + Intergenic
1184537825 22:45099625-45099647 GGCCTCCCCCAGCACAGAGAAGG - Intergenic
1185294504 22:50046623-50046645 CGGCTGCCTCAGCACAGTGTGGG - Intronic
949104313 3:185049-185071 GGGCTTCCACAGCACTTTATGGG + Intergenic
950315204 3:11995959-11995981 GGCTATCCACTTCACAGTGTTGG - Intergenic
950967217 3:17154750-17154772 TGCCCTTCACAGCACACTGTGGG + Intergenic
954003684 3:47577037-47577059 GTCCCTCCACAGCACACTCTGGG - Exonic
954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG + Exonic
955029191 3:55200005-55200027 TGCCTTCCAAAGCATATTGTAGG + Intergenic
955486376 3:59438748-59438770 GGCCTTCCTCAGGGAAGTGTTGG + Intergenic
955516997 3:59735692-59735714 GGCCTTGCACAGCACAGTAAAGG - Intergenic
956896428 3:73665470-73665492 GACATTCCACAGCACAGCCTAGG - Intergenic
958713678 3:97751136-97751158 GGTCTTCCACAGGACTCTGTCGG + Intronic
960447998 3:117771324-117771346 AGCCTTCCCCGGAACAGTGTGGG - Intergenic
961684499 3:128620355-128620377 TGCCTGCCACAGCAAAGTGCAGG + Exonic
961828285 3:129610283-129610305 GGCCTTCCACCCCACTGGGTGGG + Intergenic
965153154 3:165009336-165009358 GGACTTCCACAGCAGAGTGGTGG - Exonic
965522111 3:169678482-169678504 GCCCTTCCACAGCACAGGACTGG - Intergenic
967864282 3:194177674-194177696 TCCCTTCCACCGCACAATGTAGG - Intergenic
967963301 3:194941985-194942007 GGCCTTCCAAAGCCCAGGGGCGG - Intergenic
968784151 4:2606580-2606602 GGACTTTCACATAACAGTGTAGG - Intronic
972128481 4:35800886-35800908 GGCCTCCCACACCACAGAGCAGG + Intergenic
973146250 4:46830961-46830983 GGGCTCCCACAGTGCAGTGTCGG - Intronic
974278574 4:59759606-59759628 GGCCTCCCACTCCACAGAGTAGG - Intergenic
974447176 4:61999961-61999983 GTCCTTCTAAAGTACAGTGTTGG + Intronic
975033947 4:69658365-69658387 GGGCCCCCACAGCACAGTGGTGG + Intergenic
975064018 4:70038992-70039014 GGCCCTACACACCACAGTCTTGG + Intergenic
975403307 4:73962182-73962204 GGCTTCACACAGCACAGGGTGGG - Intergenic
976646928 4:87396386-87396408 GGGCTTCCACAGTGCAGTGGGGG + Intergenic
985536213 5:467080-467102 GGCCTTTGACAGCACAGTGAGGG - Exonic
985666384 5:1183584-1183606 GGCCTTACTGAGCACAGTGCCGG - Intergenic
987168842 5:15231450-15231472 GGCATGGCACAGCACAGTTTGGG - Intergenic
987315235 5:16717872-16717894 GGGCTTCCACAGTGCAGTGAGGG - Intronic
989665666 5:43850865-43850887 GGGCTTCCATAGAACAGAGTGGG + Intergenic
995679928 5:114704728-114704750 GGGCTCCCACAGTGCAGTGTGGG + Intergenic
999878375 5:155833945-155833967 GTCCTTCCACAACTCAGTGTAGG - Intergenic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1006168055 6:32077145-32077167 GGCCTCACAGAGCCCAGTGTGGG + Intronic
1008428653 6:51388892-51388914 GGCCTTCCACAGCTCAGTCATGG - Intergenic
1013410046 6:109876095-109876117 GGGGCTCCACAGCACAGAGTGGG + Intergenic
1016184633 6:141183437-141183459 GGGCCCCCACAGCACAGTGGTGG - Intergenic
1017220378 6:151959525-151959547 AGCCTCCCACTGCACAGCGTTGG - Intronic
1018109458 6:160520707-160520729 GGCCCGCCACAGCGCAGTGGTGG + Intergenic
1018637123 6:165872483-165872505 GGCTTTCCCCAGTGCAGTGTGGG + Intronic
1018874957 6:167814066-167814088 GGCATTTCTCAGCACATTGTAGG + Intergenic
1019122132 6:169811943-169811965 GCCCATCCACAGCACATAGTGGG - Intergenic
1020430569 7:8112858-8112880 GGGCTTCCACAGATCTGTGTGGG + Intergenic
1020760864 7:12267119-12267141 AGTCTTCCAGAACACAGTGTAGG + Intergenic
1024119759 7:46225032-46225054 GGGATTCCACAGCCCAGTGTGGG + Intergenic
1024178478 7:46864092-46864114 GGCCTCCCAGGGCACAGTGAAGG - Intergenic
1026363256 7:69622577-69622599 GTTTTTCCACAGCACAGTCTAGG - Intronic
1030883764 7:114914232-114914254 GGCCTTGCACAGACCAGTGAAGG - Intergenic
1031980128 7:128119332-128119354 GCCTTTGCACAGCACAGCGTGGG - Intergenic
1033681914 7:143603220-143603242 GGCCTCCCATATCCCAGTGTGGG - Intergenic
1033702975 7:143858693-143858715 GGCCTCCCATATCCCAGTGTGGG + Intronic
1034457835 7:151181031-151181053 GGCCCTGCAGAGCACAGTGCAGG + Exonic
1035297241 7:157874049-157874071 GGCCTGGCACAGCTCAGTGGTGG + Intronic
1035670454 8:1412980-1413002 GCCCTTCCTGACCACAGTGTGGG + Intergenic
1037017528 8:13926779-13926801 GGCATTACACTTCACAGTGTGGG - Intergenic
1037742752 8:21620504-21620526 GGCCTCCCAGAGCACACAGTAGG + Intergenic
1037778130 8:21849109-21849131 GGCCTTCCCAAACACAGTGCAGG + Intergenic
1040638763 8:49306433-49306455 GGGCCCCCACAGCACAGTGGTGG - Intergenic
1043731997 8:83694395-83694417 GGACTCCCACAGCGCAGTGGCGG + Intergenic
1049349475 8:142156626-142156648 TGCCTTCCACTGCCCTGTGTGGG + Intergenic
1049928909 9:437308-437330 GGCTTCCCACACCACAGTTTAGG + Intronic
1050327249 9:4509462-4509484 GGGTTTCCACAGTACAGTGAGGG + Intronic
1055278388 9:74645670-74645692 GGACTTGCTCATCACAGTGTAGG - Intronic
1057118100 9:92545165-92545187 GAGCTCCCACAGCACAGCGTGGG - Intronic
1059401977 9:114076343-114076365 GGCATTCCTTAGCCCAGTGTGGG - Intronic
1060231212 9:121826921-121826943 GGCCTGCCACAGGACAGGCTGGG + Intronic
1060956048 9:127640740-127640762 TCCCTTCCACACCAGAGTGTAGG + Intronic
1061057203 9:128230267-128230289 GTCCCTCCACAGCATATTGTTGG + Intronic
1061478659 9:130885440-130885462 GGCCAGCCACAGCGCAGTGCTGG + Exonic
1062037162 9:134387515-134387537 AGCCTTCCTCAGCACTGCGTGGG + Intronic
1062684098 9:137801119-137801141 GGACAGCCACAGCACAGTGCCGG - Intronic
1185652938 X:1661808-1661830 GGCCCACCACAGCCCAGAGTTGG + Intergenic
1192445519 X:71208212-71208234 GACATTCCACTTCACAGTGTTGG - Intergenic
1199265010 X:145818667-145818689 AGCCTTCCACAGGACACGGTGGG - Exonic