ID: 1122882940

View in Genome Browser
Species Human (GRCh38)
Location 14:104698146-104698168
Sequence CTTTCCAGATGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122882931_1122882940 3 Left 1122882931 14:104698120-104698142 CCTGCGCTGGTGGCCCCGCCAAC 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG 0: 1
1: 1
2: 3
3: 31
4: 363
1122882932_1122882940 -10 Left 1122882932 14:104698133-104698155 CCCCGCCAACCCACTTTCCAGAT 0: 1
1: 0
2: 1
3: 11
4: 219
Right 1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG 0: 1
1: 1
2: 3
3: 31
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122882940 Original CRISPR CTTTCCAGATGGAGAGCAGA GGG Intronic
900174699 1:1286547-1286569 CTTTCCAGAAGGAGGGAAGGTGG + Intronic
900374756 1:2348421-2348443 CTTCCCCCATGGAGGGCAGAGGG - Intronic
901742319 1:11350354-11350376 CCTTCCGGAGGGAGAGCCGAGGG - Intergenic
902091816 1:13909753-13909775 CTTTCCATAAGGCTAGCAGAAGG - Intergenic
903293624 1:22330098-22330120 CCTTCCAGGTGGAGAAGAGAGGG + Intergenic
905238333 1:36565746-36565768 GTTTCCAGGTTAAGAGCAGAGGG - Intergenic
907339951 1:53727710-53727732 CTTCCCAGAGGGAGGGGAGAGGG + Intronic
907413059 1:54295789-54295811 CATTCCAGATGGAGGGGAGAAGG - Intronic
908122896 1:61002677-61002699 CTTTCAAAATGCACAGCAGAAGG - Intronic
911271235 1:95803698-95803720 CTTTCCAGCTAGTTAGCAGAAGG + Intergenic
911903603 1:103536919-103536941 CTTTCCAAAAGTAGAGCAGAGGG + Intronic
912411416 1:109483320-109483342 CTGCCCTGATGCAGAGCAGAGGG - Intergenic
912740151 1:112187029-112187051 CTTGCCAGAGAGAGACCAGAGGG - Intergenic
915782875 1:158572477-158572499 CTTTCCTGATGGTGAGGACAGGG - Intergenic
917665347 1:177220531-177220553 CTCTCTAGAAGTAGAGCAGATGG + Intronic
917724179 1:177813659-177813681 CTTTCCAAAGGCAGACCAGAAGG + Intergenic
918070142 1:181128638-181128660 CTTGCCAGCTGAAAAGCAGAGGG - Intergenic
919172854 1:193977780-193977802 ATTTCCAGACTGACAGCAGAAGG + Intergenic
919396572 1:197057184-197057206 CTTTTCAGAAGGACAGGAGAAGG - Exonic
919420795 1:197367801-197367823 CTTTCCATACAGAGAGCAGATGG - Intronic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920187096 1:204166490-204166512 GTTTCCGGATGGGGAGCAGAGGG + Intergenic
920203391 1:204274643-204274665 CCTTGCAGCTGGAAAGCAGAAGG - Intronic
921064281 1:211611686-211611708 CTTTACAGATGGAGAGATGAAGG + Intergenic
921273706 1:213495633-213495655 TTTTACAGATGGGGAGCAGAAGG + Intergenic
922224420 1:223632933-223632955 CTTTCCAGATGGGAAGAAGGAGG - Intronic
922404339 1:225297084-225297106 CATTCCAGAAGGAGAAGAGAAGG - Intronic
922424462 1:225480490-225480512 CTTTGCAGATGAAGAGTAGTGGG + Intergenic
923071075 1:230564991-230565013 CTTTCCAGATGGCGAGAGTAGGG + Intergenic
923431837 1:233929915-233929937 CTTTCTAGAGATAGAGCAGATGG + Intronic
1064298307 10:14098968-14098990 GTTTTCAGATGAAGAACAGAAGG - Intronic
1065290602 10:24225683-24225705 CTTTCCAGATCCAGCCCAGATGG + Intronic
1066136415 10:32451132-32451154 TTTTCCTTATGGAGAGCAAAGGG + Intronic
1067247629 10:44559610-44559632 CTTTCCAGCTGGAGGGAAGTCGG + Intergenic
1067720666 10:48725398-48725420 CTTTCCTGATGGCTAACAGAGGG - Intronic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1071262617 10:83934429-83934451 CTTTCTTTATGAAGAGCAGAGGG - Intergenic
1071752465 10:88496039-88496061 CTTTCCATATGGGTTGCAGAAGG + Intronic
1073900792 10:108218008-108218030 CTTTGCAGGAGAAGAGCAGAGGG + Intergenic
1074254009 10:111782381-111782403 CTTTCAGGAAGGAGAGCAGCGGG + Intergenic
1074375498 10:112937936-112937958 CTTTCCAGTAGCAAAGCAGAAGG - Intergenic
1074596900 10:114876219-114876241 CTTTCCTCAGGGAGAACAGAAGG + Intronic
1074736558 10:116440387-116440409 CTTTCCAAATGGAGGGAAGTGGG - Intronic
1074881880 10:117666037-117666059 CTCCCCAGAAGCAGAGCAGATGG - Intergenic
1074937654 10:118201778-118201800 CTTTCAAGATGAAGCACAGAAGG - Intergenic
1075167698 10:120084150-120084172 CTTTTCATATGTATAGCAGACGG + Intergenic
1075617832 10:123904413-123904435 CTTTCCAGATGAAGACCCCAAGG - Intronic
1076217340 10:128706662-128706684 CTTTCCAGATGGTAAGATGATGG + Intergenic
1076393654 10:130122266-130122288 CTGTCCACAGGGAGAGGAGAGGG - Intergenic
1077024951 11:435053-435075 ATTTCCAGATAAACAGCAGAAGG + Intronic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077556776 11:3229839-3229861 CTTTCCCCATGGGGAGAAGAGGG + Intronic
1079132995 11:17760448-17760470 CCTTCCTCCTGGAGAGCAGATGG - Intronic
1079281905 11:19095191-19095213 CTTTCCAGATGGAAGGGAGAAGG + Intergenic
1079524461 11:21367836-21367858 CTTTCCAGTTTGTGAGGAGATGG - Intronic
1079967121 11:26993404-26993426 TTTTCCAGATGGAGAAATGAAGG - Intergenic
1080175090 11:29353819-29353841 CTTTTAAGATGAAAAGCAGATGG + Intergenic
1080576467 11:33603986-33604008 CTTTCCAGAAGGTAACCAGATGG - Intronic
1080763389 11:35273959-35273981 CTTTACAGATGAAAAGGAGAGGG + Intronic
1081011078 11:37812710-37812732 CTTCCCAGCTGGAGAGTACAGGG + Intergenic
1081491752 11:43574950-43574972 CTCTTCGGGTGGAGAGCAGAGGG + Intronic
1081548017 11:44085759-44085781 AATTCCAGAGGGAGAGAAGAGGG - Intergenic
1082820646 11:57542633-57542655 CTTTCCAGAGATGGAGCAGAAGG + Exonic
1084166378 11:67376544-67376566 ATTTCCAGCTGGAAATCAGAGGG - Intronic
1084750977 11:71204402-71204424 CTTTACAGAGGCAGCGCAGATGG - Intronic
1084972576 11:72779999-72780021 ATTTCCAGGAGGATAGCAGAAGG + Intronic
1085085483 11:73663929-73663951 CTTTCCACACAGAGAACAGATGG + Intergenic
1085461285 11:76695419-76695441 CTTCCCAGATGGAGTCCACAGGG - Intergenic
1085792872 11:79511023-79511045 CTTTGCTGATGGACAGCAGGAGG - Intergenic
1086571699 11:88292375-88292397 TTTTCCAGTTGGACAGCAGTCGG - Intergenic
1086928618 11:92668004-92668026 CTTTCCTAATGGAGAGCCCAAGG - Intronic
1086952419 11:92904875-92904897 CTTTCAAGATGGAGAGCTGAGGG + Intergenic
1087492463 11:98845574-98845596 CTTGGCAGATGGAGAGGACAGGG - Intergenic
1088824639 11:113483466-113483488 CTATCCAGATGCTGAGCAAAAGG - Intergenic
1088863148 11:113821037-113821059 CCTTCCAGTTGGGGAGGAGAAGG + Intronic
1088929761 11:114339837-114339859 CCTTGCATATGGGGAGCAGAGGG + Intergenic
1088952562 11:114586424-114586446 ATTTTTAAATGGAGAGCAGAAGG - Intronic
1089462402 11:118660854-118660876 CTTGCCAGAAGGTGAGCAGCAGG - Exonic
1089501428 11:118933880-118933902 CTTGACAGATGGAGAACACAAGG - Intronic
1089730419 11:120515512-120515534 CCATACAGAGGGAGAGCAGAAGG - Intronic
1090053413 11:123401110-123401132 CTTTCTAGATGAAGAGATGAAGG + Intergenic
1091532925 12:1376821-1376843 CTTTACGGATGGAGAGGGGAAGG - Intronic
1092515429 12:9206953-9206975 CTTTCTGGATGGAGAGCAGCTGG + Intronic
1092803051 12:12190244-12190266 GTTTCCAGATGGGGATCAGGAGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1095639035 12:44466042-44466064 CTTCTCTGATGTAGAGCAGAAGG + Intergenic
1095726747 12:45462234-45462256 CTTTCCACATGAAGCACAGAGGG - Intergenic
1095931495 12:47630464-47630486 TTTTCCAGACAGAGAGAAGACGG - Intergenic
1096752200 12:53767860-53767882 TTTTCCAGAAGGAGGGTAGAGGG + Intergenic
1100225410 12:92551312-92551334 TTTTTCAGATGGAGAGAAGACGG + Intergenic
1101345860 12:103885529-103885551 ATTTCCAGAAGGAGGGAAGATGG + Intergenic
1102556662 12:113731215-113731237 CTTGGCAGAGGGAGACCAGACGG - Intergenic
1102717026 12:114982848-114982870 CATTCCAGCTGGAGAAAAGAGGG + Intergenic
1102720262 12:115009891-115009913 CTAGCCTGATGAAGAGCAGAGGG + Intergenic
1103499734 12:121392079-121392101 CTCTGCAGCTGGAGAACAGATGG - Intronic
1107754868 13:43609905-43609927 TTCTCCAGATGGACAGAAGATGG - Intronic
1107812442 13:44213379-44213401 CTTTCCAGGCTTAGAGCAGAGGG - Intergenic
1110867764 13:80416807-80416829 CTTACCAGATGGAGAAAAGGAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1114759092 14:25291546-25291568 CTTTCCATATGAAAATCAGATGG + Intergenic
1115328621 14:32169381-32169403 ATTTCCTGTTGGAGAGCAGATGG - Intergenic
1117184381 14:53225744-53225766 CATTCCAGAAGGAGAAGAGAAGG - Intergenic
1117531653 14:56665758-56665780 CTCTCCAGATGGAGAACACCAGG - Intronic
1117627179 14:57651856-57651878 CTTACCAGAGGCAGAGCAGTGGG + Intronic
1119497300 14:75091125-75091147 CTTTCCAGGTAGAAATCAGAAGG + Intronic
1119646782 14:76354125-76354147 CATTCCAGATGGAGAGGTCAGGG - Intronic
1120769106 14:88359143-88359165 GTTTCCAGATGGAGGAAAGAGGG - Intergenic
1121798538 14:96754987-96755009 CTAAGCAGATGCAGAGCAGATGG + Intergenic
1121943133 14:98092375-98092397 CTTTCCAGAAGGACAGCACCTGG - Intergenic
1122517458 14:102318954-102318976 CTTTCCCCAGGGAGAGCAGGAGG - Intronic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1123574917 15:21656659-21656681 CCTCCCTGGTGGAGAGCAGAGGG - Intergenic
1123611532 15:22099148-22099170 CCTCCCTGGTGGAGAGCAGAGGG - Intergenic
1124169533 15:27360380-27360402 ACTCCCAGATGGAGAGCAGCTGG - Intronic
1124476085 15:30035957-30035979 CTCACTAGATGGAGAGCATAGGG - Intergenic
1124608759 15:31193273-31193295 TTTTCCTGAGGGAAAGCAGATGG - Intergenic
1124832765 15:33165356-33165378 CTTTCCAATTAGAGAGCACAAGG + Intronic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1125958317 15:43807008-43807030 CATTCCAGGTGGAGACCAGCAGG - Intronic
1127773739 15:62250266-62250288 CTTTCCAGATGGAGGAGTGAGGG - Intergenic
1129227328 15:74177658-74177680 CTCTCCAGATGAGGAGCATAAGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1131538340 15:93255664-93255686 ATTTCAAGATGGTGAGCATAGGG - Intergenic
1202983785 15_KI270727v1_random:390903-390925 CCTCCCTGGTGGAGAGCAGAGGG - Intergenic
1133172927 16:3992864-3992886 TTTGGCAGATGGAGAGCAGATGG + Intronic
1133375691 16:5285065-5285087 AGTTCCAGATGGAGATGAGATGG - Intergenic
1134060450 16:11196611-11196633 CTTTCCAGATGAAGACCATGAGG + Intergenic
1134783235 16:16917689-16917711 CATTCCAGATGGAGAACTTAGGG - Intergenic
1135893205 16:26375361-26375383 CTTTCCAGATAAGGAGAAGATGG + Intergenic
1136354860 16:29737801-29737823 TTTCCCAGAAGGAGTGCAGAGGG + Intergenic
1137535907 16:49325572-49325594 CTTTCCAGGCGGAGATGAGAGGG - Intergenic
1137621723 16:49880706-49880728 CTTACCAGGTGGAGAGGATATGG + Intergenic
1138194990 16:55045393-55045415 TTTCCAACATGGAGAGCAGAGGG - Intergenic
1138830265 16:60366830-60366852 CTTCCCTGATGGACAGCAAAGGG - Intergenic
1139006867 16:62583643-62583665 CTCTCCTGATGGAAATCAGAAGG - Intergenic
1140649423 16:77070828-77070850 GATTCCAGAAGGAGAGGAGAGGG + Intergenic
1140995591 16:80256239-80256261 CTTCCCAGATCTAGAGCTGAGGG + Intergenic
1141046817 16:80722963-80722985 ATTTCCACAAGCAGAGCAGAAGG + Intronic
1142872393 17:2829293-2829315 CTTTCCTGATGTAGCTCAGATGG + Intronic
1143090537 17:4446985-4447007 CGGTCCAGAGGGAAAGCAGAGGG - Intronic
1143566815 17:7727101-7727123 TTCTACAGAAGGAGAGCAGAGGG - Exonic
1143652964 17:8275656-8275678 CTGGCCTGTTGGAGAGCAGAGGG - Intergenic
1144010730 17:11146358-11146380 CTTTCCAGATGTGGGGCACAAGG - Intergenic
1144384955 17:14740828-14740850 CTTTTCAAATGGAGAACAGGGGG - Intergenic
1144672045 17:17138336-17138358 CCTTCCAGGTGGAGAGAAGGCGG + Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1145786475 17:27597179-27597201 CTTTCCAGATGGGGAAGGGAGGG + Intronic
1146771173 17:35569887-35569909 CTTTCTAGATGGAGGGCATAAGG + Intergenic
1147155953 17:38544608-38544630 GTTTACAGATACAGAGCAGAAGG + Intronic
1147497847 17:40935011-40935033 TTTTGCAAATGGAGAGCAAAGGG - Intronic
1148199952 17:45743646-45743668 TGTTCCACCTGGAGAGCAGATGG - Intergenic
1150472162 17:65446579-65446601 CCTTCCAGATGCAGTGCAGTAGG + Intergenic
1150546639 17:66165159-66165181 CTGACCAGATGGAGAGCTGGTGG - Intronic
1151259743 17:72907156-72907178 CTGTCCTGCTGGAGAGCACAAGG + Intronic
1151439223 17:74117402-74117424 CTCTCTGGATGGAGAGCTGAAGG - Intergenic
1152579438 17:81159641-81159663 ATTCCCAGAAGCAGAGCAGAAGG + Intronic
1153391642 18:4568572-4568594 ATTTCCACATGGAGAAGAGAGGG - Intergenic
1153503594 18:5772553-5772575 ATTTCCAGATGGAGTGCAGCAGG + Intergenic
1153586098 18:6622154-6622176 CTTTCCAGATGGAGAAATGGAGG - Intergenic
1154336667 18:13471431-13471453 CTTTCGTAATGGAGAGAAGAGGG + Intronic
1154382955 18:13869106-13869128 GTTTTCAGCTGGAGAGCAGACGG + Intergenic
1156060247 18:33065468-33065490 ATTTCCAGAAGGAGACGAGATGG + Intronic
1156292102 18:35756216-35756238 CTTCCCAGCAGCAGAGCAGACGG + Intergenic
1156997051 18:43481367-43481389 CTTTCCAGATGGAGGTCATTAGG + Intergenic
1157225766 18:45862699-45862721 CTCTCCAGAGGCCGAGCAGATGG + Intronic
1157325799 18:46668188-46668210 CTTTCCCGATGGAGAAGAGAAGG - Intronic
1158623154 18:59049830-59049852 CCCTTCAGAAGGAGAGCAGAAGG - Intergenic
1158934123 18:62349034-62349056 CTATCCAGATGGAAGGCAGAGGG + Intronic
1159471721 18:68866573-68866595 CTTTTCTGATACAGAGCAGAGGG - Intronic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1161878453 19:6930063-6930085 CTTTTCTAATGGAGAGCAGCCGG - Intronic
1161922346 19:7275941-7275963 TTTTCCAGAAGGAGAGAAGGCGG + Intronic
1163888897 19:19993563-19993585 CTATTCAGAAGGAGACCAGAGGG - Intergenic
1164231745 19:23294938-23294960 CTTTCTAGATGCAGAGGACAGGG - Intergenic
1164247887 19:23449436-23449458 CTTTCTAGATGCAGAGGACAGGG - Intergenic
1164390316 19:27814074-27814096 CCTTCCAGATGCAGAGGACAGGG - Intergenic
1164633381 19:29776036-29776058 TTTTGCAGATGGAAAGGAGAAGG + Intergenic
1166963767 19:46515409-46515431 CTTTCCAGATCTGGAGCACATGG - Intronic
1167236607 19:48319448-48319470 CTTTGGAGATGGGGAGCATACGG - Exonic
1167271402 19:48508583-48508605 CTTTCCAGATGAAGATCCGGAGG + Intronic
1168593359 19:57654577-57654599 CTTTCCAGATGGCCAGGATAGGG - Intergenic
925472315 2:4175664-4175686 CTCTCCAGATTAAGGGCAGAGGG + Intergenic
926043047 2:9690217-9690239 CTTTCCTGGTGGAGGGCAGTGGG + Intergenic
926398289 2:12468348-12468370 CTTTGCAGGTGGAGAGGACAAGG + Intergenic
926430239 2:12778347-12778369 ATTTCCAGATGGAGAGAATCTGG - Intergenic
927436627 2:23072061-23072083 CTTGCCAGCTGGAGAGAGGAGGG + Intergenic
928076446 2:28269282-28269304 CTTCCAAGATGGAGAGGAGAAGG - Intronic
928405846 2:31014293-31014315 CTATCCAGATCCAGAGCTGATGG - Intronic
928994995 2:37279773-37279795 CTTTCCACATCGAGATCAGATGG + Exonic
929368372 2:41190227-41190249 CTTTCCAGATGAATGGCAGCTGG + Intergenic
929908628 2:46069234-46069256 CTTTCCAGGTGGTGAGCAACAGG - Intronic
930031264 2:47059419-47059441 CTGCCCTGATGGAGAGCTGATGG - Intronic
932090518 2:68801859-68801881 GTTTCCAGGTGGAGAGTAGGAGG + Intronic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
934477541 2:94603396-94603418 CTTTTCGGGTGGAGAGCTGATGG + Exonic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
935716851 2:105946951-105946973 CTTTCCATATGGACAGCTGAAGG + Intergenic
936339103 2:111615714-111615736 CTTTCCAGAAGTGGAGCAGATGG + Intergenic
938055022 2:128208332-128208354 CTTGCCAGATGGTGGGCAGCCGG - Intergenic
938055270 2:128209473-128209495 CTTCCCAGATGGTGGGCAGCCGG - Intergenic
938645744 2:133328283-133328305 ATTTTCAGATGGAGAATAGAGGG + Intronic
939165352 2:138635705-138635727 TTTTCCATATGGAGTTCAGAAGG - Intergenic
939189102 2:138895488-138895510 CATTCCAGCTGGTGAGAAGATGG + Intergenic
941037591 2:160585040-160585062 CACTCAAGATGCAGAGCAGAGGG - Intergenic
941116846 2:161481517-161481539 CATTCCAGAAGGAGAAGAGAAGG + Intronic
942642479 2:178074202-178074224 CTTTCTAGATGGAGAGGAAGTGG + Intronic
943657572 2:190525921-190525943 CTTTCAAGATGGAGTCCACATGG - Intronic
944229852 2:197381553-197381575 CTTCCCAGATGGTGGGCAGCCGG - Intergenic
944684823 2:202109052-202109074 CCTTCCAGATGGAAGTCAGAGGG - Intronic
945355927 2:208839397-208839419 GTTTCAAGGTAGAGAGCAGAGGG + Intronic
947134615 2:226964809-226964831 CTTTACAAATGGATAGTAGAAGG + Intronic
947979081 2:234393527-234393549 CTTTGCAGATCATGAGCAGAAGG - Intergenic
948160007 2:235815586-235815608 CATTCCAGATGGAAAGAACATGG - Intronic
1169523536 20:6398809-6398831 CTTTCCAGGTGGAAAGAATAAGG - Intergenic
1169611654 20:7387594-7387616 CTTTCCATGTGCAAAGCAGAGGG + Intergenic
1169642121 20:7764548-7764570 CATTTCAGATGGAGAGAAAAAGG + Intergenic
1170666070 20:18387216-18387238 CTCCCCATATTGAGAGCAGAGGG + Intronic
1172157558 20:32839225-32839247 CTTTCCAGATGGGGAGCAGTGGG + Intronic
1172839610 20:37894456-37894478 ATTTCCTGCTGCAGAGCAGAGGG - Intergenic
1173110938 20:40189544-40189566 CTTTCTAAATGGAGACCAGATGG - Intergenic
1173412499 20:42826285-42826307 TTTACCAGATGGAGAGGAAAAGG + Intronic
1173896550 20:46555419-46555441 CTCCCCAGAAGGAGAGCTGAGGG + Intergenic
1174398804 20:50264764-50264786 TTTTCCAGATGGAGAGAATGAGG - Intergenic
1174400076 20:50271203-50271225 TTTCCCAGATGGAGACCAAAGGG - Intergenic
1174903477 20:54525012-54525034 CTGTCCAGTGGGAGAGCAGGCGG + Intronic
1175277760 20:57783509-57783531 CTTTCCAGGAGGAGGGCAGGTGG + Intergenic
1177354816 21:19994929-19994951 CTTTCCAGATTTAGAGCATTTGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1178694990 21:34785389-34785411 TTTTTCAGAGGGAGAGAAGATGG - Intergenic
1179967908 21:44817687-44817709 CTTCCCAGCTGGGGAGGAGACGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182615544 22:31586720-31586742 TATTCAAGGTGGAGAGCAGAGGG + Intronic
1183177809 22:36237296-36237318 CTCTCCAGATGCAGAGGACAGGG + Intronic
1184330241 22:43822503-43822525 CTTTTCAGATGAAGAGCGGGGGG + Intergenic
1184459501 22:44628975-44628997 CTTCCCAGATGGTGGGCAGCTGG - Intergenic
1185024140 22:48397888-48397910 TTCTCCAGTTGGAGAGCACAAGG + Intergenic
1185082200 22:48715658-48715680 CTGTCCTGCTGGAGAGAAGAGGG + Intronic
950764934 3:15266604-15266626 CTCCCCAGCTGGAGAGCAGCAGG + Intronic
952271174 3:31833089-31833111 CTTTTCACTTGGAGAGTAGAGGG + Intronic
952739312 3:36720280-36720302 CTTATCAGAAGCAGAGCAGATGG + Intronic
952843559 3:37668177-37668199 CTTTCTAGATGGTGAGAGGATGG + Intronic
952927915 3:38335343-38335365 TATTCCAGATGAAGAGCTGAAGG + Intergenic
953351870 3:42222054-42222076 GTTTCCAGAAGGGCAGCAGAGGG - Intronic
953383045 3:42488715-42488737 TCTTCCAGATGGAAAGCAGGTGG + Intergenic
954635292 3:52067897-52067919 TTTTTCAGATGGAAAGCTGAGGG + Intergenic
955252840 3:57301993-57302015 CTTTCCAGAAGAAGAACAGCAGG + Intronic
955380666 3:58435313-58435335 ACTTCCAGATGGAGAGGAGGGGG + Intergenic
956449022 3:69355217-69355239 CTATCAAGAGGGAGAGCACAAGG + Intronic
957246193 3:77719756-77719778 CTCCCCAGAAGCAGAGCAGATGG + Intergenic
957895740 3:86419344-86419366 CTTCTCAGATGGCGAGCAGCTGG + Intergenic
958406970 3:93763763-93763785 CCTCCCAGATGAAGAGCAGCTGG + Intergenic
959234271 3:103698316-103698338 CTTTGCAGAGAGAGGGCAGATGG + Intergenic
960056331 3:113279036-113279058 CTTTGCAGAAGGATAGCATAAGG + Intronic
961275443 3:125722383-125722405 ATTTCCAGAGGGAGAGAGGATGG - Intergenic
961433913 3:126903178-126903200 ACTTCCAGGTGGAGTGCAGAGGG - Intronic
962317218 3:134366492-134366514 CTTTTCTGATGGAGAGTAGTGGG - Intronic
962680829 3:137798489-137798511 CTTTCCAGATAGAGAAATGAAGG - Intergenic
963174025 3:142280092-142280114 CTTTCCAGATCAAGGGCAGAGGG - Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
963785681 3:149532103-149532125 CTTTACAAATGAAGAACAGAGGG - Intronic
964024643 3:152057925-152057947 CATTCCAGCTGAACAGCAGAGGG - Intergenic
965067052 3:163863599-163863621 ATTTTCAGAAAGAGAGCAGATGG + Intergenic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
966255671 3:177914308-177914330 CTTCCCAGATGGTGGGCAGCTGG + Intergenic
966728539 3:183130971-183130993 CTTTCCAGGTGGAGAGCAGAGGG - Intronic
970063044 4:12057179-12057201 TTTTCCAGATGGAGAAAAGTGGG - Intergenic
973370119 4:49238562-49238584 CTTCCCAGATAGAGGGAAGAGGG + Intergenic
973390907 4:49556850-49556872 CTTCCCAGATAGAGGGAAGAGGG - Intergenic
974157688 4:58095298-58095320 CTTTCCAGAAGCTGAACAGATGG - Intergenic
975547642 4:75575950-75575972 CTTTCCAGGTCTAGAGCAGGTGG + Intergenic
977768898 4:100833323-100833345 CCTTTCAGCTGGAGAGCTGAAGG - Intronic
978335765 4:107667200-107667222 CTTCCCAGTTGGTGAGCACACGG + Intronic
978496770 4:109367946-109367968 CATTCTAGTTTGAGAGCAGATGG + Intergenic
978642638 4:110889643-110889665 CTTTCAAGAAGGAAAGAAGAGGG - Intergenic
978761361 4:112358432-112358454 CTTTCCTGGTGGAGAGGAGGGGG - Intronic
979001421 4:115225665-115225687 CTTTGCCCATGGAGAGGAGAGGG + Intergenic
980025837 4:127765377-127765399 TTTGCCAGATGGAGAGAATAGGG - Intronic
980152029 4:129059950-129059972 CTTTCCAGAAGGAGAAGAGAAGG - Intronic
981871681 4:149494618-149494640 GTTTGCAGATGGAGTGCTGAAGG - Intergenic
982319750 4:154065862-154065884 CCTTCCAGACGGAGAAGAGAAGG - Intergenic
983645659 4:169988958-169988980 GTTTCCACATGGAAAGGAGAAGG - Exonic
986331563 5:6720091-6720113 CTTTGCAGATGGAATGCAGGTGG - Intronic
986649788 5:9951675-9951697 CTTTGCAGATAGAGAACAGCAGG + Intergenic
987231311 5:15896544-15896566 CTTTCCAGCTGGAGAACTGGTGG - Intronic
987668899 5:20983175-20983197 CTTTCCCTATGGAGAGCAATGGG - Intergenic
989081676 5:37629382-37629404 CATTCCAGATGGAAAAAAGAAGG - Intronic
989815950 5:45737655-45737677 CTTTCCAGATGGAGATGATGGGG - Intergenic
990240731 5:53813730-53813752 CTTTCCTGATGAAGAAAAGAGGG + Intergenic
990941243 5:61205166-61205188 CTTGCCAGATGGTGGGCAGTCGG - Intergenic
992058794 5:73021053-73021075 CTTTCCAGAGGGAGAGGACCAGG - Intronic
992676973 5:79114716-79114738 TTTTCCAGATGGGGAGCATAGGG - Intronic
993080741 5:83296043-83296065 CTTTCCAGTGGGAGATAAGAGGG + Intronic
993875376 5:93300333-93300355 TTTTTGAGATGGAGAGCAAAAGG - Intergenic
993990970 5:94658737-94658759 ATTTCCAGATGGAGAAGTGATGG - Intronic
995431769 5:112087346-112087368 CATTCCAGATAAAGAGAAGAGGG + Intergenic
996639009 5:125730285-125730307 CTTTCCACAGGGAGCTCAGAAGG - Intergenic
997236151 5:132272936-132272958 ATTTCCAGACAGAGACCAGAAGG + Exonic
999430593 5:151521986-151522008 ATCTCCAGTGGGAGAGCAGAAGG + Exonic
1001309980 5:170603648-170603670 CTAGCCAGATAGAGAACAGAGGG + Intronic
1001740653 5:174050530-174050552 CTTTACAGATGAAGAGTGGAAGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002304442 5:178274951-178274973 CTTTCCCCATGGAGATCAGCCGG + Intronic
1002777328 6:340361-340383 CTTTCCAGCTGGAAGGCTGATGG - Intronic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1004063630 6:12222044-12222066 TCTCCCAGATGGAGAGCAGCCGG + Intergenic
1005181889 6:23115604-23115626 CTCTCCAGACCAAGAGCAGAGGG + Intergenic
1007612500 6:43159707-43159729 CGTTCCAGATGGGGAGATGAGGG + Intronic
1009673423 6:66787164-66787186 GTTTCCAGAAGGACAGTAGATGG - Intergenic
1011068728 6:83359033-83359055 CTTCCCAGATGGTGGGCAGCTGG + Intronic
1011865975 6:91827956-91827978 ATATCCAGATGGAGTGAAGAAGG - Intergenic
1014814600 6:125921517-125921539 CTTTTCAGAGGCAGAGCAGGGGG - Intronic
1015516667 6:134089167-134089189 CTTTCAAGAAGTAGAGCACAAGG + Intergenic
1015631249 6:135234046-135234068 CAATCCAGAGGCAGAGCAGATGG - Intergenic
1018488304 6:164265161-164265183 CTATCCAGATAGAGTGCACATGG + Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1024268911 7:47627552-47627574 CTTTCCATGCGGTGAGCAGAAGG - Intergenic
1024461125 7:49660625-49660647 CTTTGCATATTGAGAGCATATGG + Intergenic
1024608844 7:51045967-51045989 TTATCCACATGGAGAGCAGGAGG - Intronic
1024724871 7:52181728-52181750 TTCTCCACATGGATAGCAGATGG + Intergenic
1024966773 7:55030048-55030070 CTTTCCAGATTGGGAGGTGAGGG + Intronic
1027235977 7:76297986-76298008 CTTCCCTGATGGGGAGCAGGTGG + Intergenic
1027703213 7:81494996-81495018 TTTTCTAGATGGAGAACAGTGGG - Intergenic
1028619967 7:92814520-92814542 CTTTCCTGGTTGGGAGCAGAAGG - Intronic
1029553363 7:101250720-101250742 CTTTCTAACTGGATAGCAGATGG - Intronic
1030021007 7:105275195-105275217 CTTTCCTTGTGGAGAGCAGCAGG + Intronic
1030539227 7:110808599-110808621 CTTTGCAGCTGCAGTGCAGATGG + Intronic
1031334816 7:120515296-120515318 CCTTCCAGATGGAGAGATCAGGG - Intronic
1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG + Intronic
1037481315 8:19308351-19308373 GTCTCTTGATGGAGAGCAGATGG - Intergenic
1038488503 8:27953077-27953099 CAATCCAGACGGAAAGCAGATGG + Intronic
1039834870 8:41248164-41248186 CTCTCCAGCTGGAGTGCAGGTGG - Intergenic
1039981509 8:42412756-42412778 CTAGCCACACGGAGAGCAGATGG + Intergenic
1040440265 8:47434215-47434237 CTGTCCACATGGGAAGCAGATGG + Intronic
1040517788 8:48148538-48148560 CTTCCCAGATGGTGGGCAGCTGG - Intergenic
1040706074 8:50129353-50129375 CTGTCCAGGTGGAATGCAGAAGG + Intronic
1041138183 8:54783539-54783561 CTTTGCAGATGGAGACTGGAAGG + Intergenic
1042450622 8:68940966-68940988 CTTTAAAGTGGGAGAGCAGAGGG + Intergenic
1042521161 8:69712195-69712217 ATTTCCAGCTGGAAAGCAGCAGG - Intronic
1043238607 8:77901610-77901632 CCTTCCAAATGGAAAGCAGGAGG - Intergenic
1043419917 8:80087759-80087781 CTTCCCAGAGGGAGACCAGTGGG + Intronic
1044219440 8:89651559-89651581 CATTCCAGAAGGAGAGAAAAAGG + Intergenic
1044998664 8:97861178-97861200 ATTTTCAGATGGAGACCAAAAGG - Intergenic
1045064685 8:98435012-98435034 CAGTCCAGGTGGAGAGCAGTGGG - Intronic
1045396919 8:101770182-101770204 GTATCCAGTTGGAGAGCACAGGG - Intronic
1047331851 8:123896489-123896511 CTTTCCAGAATCAAAGCAGAAGG - Intronic
1047420831 8:124706961-124706983 CTGTCCAGAGGGACAGCAGTTGG + Intronic
1048508839 8:135044216-135044238 CTATCCAGACAGAGGGCAGAGGG + Intergenic
1049202401 8:141346734-141346756 CCTTGCAGATGGAGTGCAGATGG - Intergenic
1049401790 8:142431143-142431165 CTTTCCTGGTGGTGGGCAGAGGG - Intergenic
1049421687 8:142519422-142519444 CCACCCAGCTGGAGAGCAGAGGG - Intronic
1050455662 9:5832328-5832350 ATTTCCATCTGGAAAGCAGAAGG + Intronic
1050964975 9:11788383-11788405 CCTTCCAGGTGGAAAGCAGGTGG - Intergenic
1052836184 9:33251833-33251855 CTTACCACAGGGAGAACAGATGG - Intronic
1053680527 9:40482711-40482733 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1053930516 9:43111022-43111044 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1054283185 9:63142224-63142246 CTTTTCGGGTGGAGAGCTGATGG + Intergenic
1054293612 9:63318226-63318248 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1054391633 9:64622715-64622737 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1054504094 9:65893613-65893635 CTTTTCGGGTGGAGAGCTGATGG + Exonic
1054983119 9:71230276-71230298 TTGTGCAGATCGAGAGCAGAAGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055775625 9:79764393-79764415 CTTTCCAGAGGCAGAGAATAAGG - Intergenic
1056255750 9:84797454-84797476 ATTTCCACATGAAGAGAAGAGGG - Intronic
1057263136 9:93597441-93597463 CTTTCCTGACAGAGAGCAGGTGG - Intronic
1059463817 9:114452759-114452781 CCTCCCTGATGGAGGGCAGATGG + Intronic
1060419061 9:123454572-123454594 CATGCCAGATGGAGACTAGAAGG - Intronic
1061423332 9:130483972-130483994 CATTCCAGATGGAGAATGGAGGG + Intronic
1186257225 X:7735743-7735765 CTCTCCAGAAGCAGAGCAGGTGG - Intergenic
1186733334 X:12433903-12433925 CTTTATAGGTGGAGAGAAGAAGG + Intronic
1186733370 X:12434344-12434366 CTTTATAGGTGGAGAGAAGAAGG - Intronic
1186788040 X:12971598-12971620 CTTACCAGAAGAAGAGAAGAAGG - Intergenic
1186868941 X:13750373-13750395 CTTTCCAGATTACCAGCAGAGGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1189258440 X:39658923-39658945 CTTTTCAAAGGCAGAGCAGAAGG - Intergenic
1190160924 X:48030842-48030864 CTTTACAGATGGAGCGAACATGG + Intronic
1192455160 X:71270040-71270062 CTTTCCAGATGGGTGGCAGCTGG + Intergenic
1192455182 X:71270130-71270152 CTTCCCAGATGGTGGGCAGCCGG + Intergenic
1192455199 X:71270209-71270231 CTTCCCAGATGGCGGGCAGCTGG + Intergenic
1192590167 X:72352938-72352960 CTCTCCAGAGGGAGAGCATATGG + Intronic
1192885713 X:75334877-75334899 CTTCCCAGATGAAGAGCGGCCGG + Intergenic
1195281236 X:103335694-103335716 GTTACCAGAAGGATAGCAGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198956330 X:142135740-142135762 CTTAACAGAGGGAGAGCACAGGG + Intergenic
1199856320 X:151761855-151761877 CTTGCCAGAAGGAGAATAGAAGG - Intergenic
1200376004 X:155781021-155781043 CATTCCAGATGGAGAGCTATAGG - Exonic
1201849233 Y:18459347-18459369 CTTTCCAGATAACCAGCAGAGGG - Intergenic
1201861978 Y:18608452-18608474 CTTTCCAGATTACCAGCAGAGGG - Intergenic
1201871345 Y:18711928-18711950 CTTTCCAGATTACCAGCAGAGGG + Intergenic
1201884085 Y:18861028-18861050 CTTTCCAGATAACCAGCAGAGGG + Intergenic
1202164591 Y:21973354-21973376 CCTTCCAGATTGCCAGCAGAGGG + Intergenic
1202226765 Y:22613018-22613040 CCTTCCAGATTGCCAGCAGAGGG - Intergenic
1202316356 Y:23582642-23582664 CCTTCCAGATTGCCAGCAGAGGG + Intergenic
1202350808 Y:23988914-23988936 CTTTCCAGATTACCAGCAGAGGG + Intergenic
1202519971 Y:25681205-25681227 CTTTCCAGATTACCAGCAGAGGG - Intergenic
1202554408 Y:26087416-26087438 CCTTCCAGATTGCCAGCAGAGGG - Intergenic