ID: 1122883698

View in Genome Browser
Species Human (GRCh38)
Location 14:104701216-104701238
Sequence CGTGCCATGCTGAGGGTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122883698_1122883706 20 Left 1122883698 14:104701216-104701238 CCCCTAACCCTCAGCATGGCACG 0: 1
1: 0
2: 0
3: 13
4: 78
Right 1122883706 14:104701259-104701281 GAAACTGAGACCGAGGGAAGTGG 0: 1
1: 0
2: 9
3: 86
4: 578
1122883698_1122883705 14 Left 1122883698 14:104701216-104701238 CCCCTAACCCTCAGCATGGCACG 0: 1
1: 0
2: 0
3: 13
4: 78
Right 1122883705 14:104701253-104701275 AGCAGAGAAACTGAGACCGAGGG 0: 1
1: 0
2: 2
3: 34
4: 369
1122883698_1122883704 13 Left 1122883698 14:104701216-104701238 CCCCTAACCCTCAGCATGGCACG 0: 1
1: 0
2: 0
3: 13
4: 78
Right 1122883704 14:104701252-104701274 CAGCAGAGAAACTGAGACCGAGG 0: 1
1: 0
2: 1
3: 31
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122883698 Original CRISPR CGTGCCATGCTGAGGGTTAG GGG (reversed) Intronic
901321538 1:8343236-8343258 CATGCCATGCTGGGGGACAGTGG - Intronic
905216894 1:36415063-36415085 CGAGGCTTGGTGAGGGTTAGTGG + Intergenic
905448425 1:38042548-38042570 TGTGCCATGCTGAGAGTTCCTGG - Intergenic
905853466 1:41291154-41291176 CGTGCCTGCCTGAGGGTCAGTGG + Intergenic
906209902 1:44006972-44006994 CATGCCAGGCTAAGGGTTTGAGG - Intronic
910158755 1:84251334-84251356 CGTGTAATGCTGAGGTTTAGGGG + Intergenic
910874201 1:91862659-91862681 TGTGCCAGGCTCAGGGATAGAGG - Intronic
912091461 1:106081269-106081291 CGTGCCATTCAGAGGGATGGTGG + Intergenic
917662142 1:177187231-177187253 TGTGGCAGGGTGAGGGTTAGGGG - Intronic
924287884 1:242506985-242507007 CGTGTCATGCCAAGGGTGAGAGG + Intronic
1063002184 10:1934847-1934869 CGTGCCAGGCGGAGGGTCAGCGG + Intergenic
1065358531 10:24867148-24867170 CTTGTCATGCTGTGAGTTAGAGG - Intronic
1070553429 10:77509862-77509884 TGTGCCTTGCTGAGGGTGGGAGG - Intronic
1073080074 10:100854112-100854134 AGGGCCATGGTGAGGGTGAGGGG - Intergenic
1073483104 10:103799312-103799334 CCTGCCATGATGAGTTTTAGTGG - Intronic
1073517612 10:104091299-104091321 AGTGTCATTCTGAGGGTGAGGGG + Intergenic
1073713151 10:106068972-106068994 CCTGCCATGCAGGGGGTGAGTGG - Intergenic
1074043949 10:109819782-109819804 CTTGCCGTGTTGAGGGTCAGAGG - Intergenic
1077026158 11:440991-441013 CCTCCCATGCTGGGGGTTAGAGG - Intronic
1084675461 11:70631349-70631371 CGTGCCATTCTGAGGGTTCCCGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1089199285 11:116714165-116714187 AATGCCAGGCTGAGGGTTTGGGG - Intergenic
1090910925 11:131118583-131118605 TGTGCCAGGCAGAAGGTTAGTGG + Intergenic
1091686250 12:2564917-2564939 GGGGCCATGCTGAGGGCTTGGGG - Intronic
1096676540 12:53229478-53229500 GGTGCCATGGTGAGGGGCAGGGG - Intronic
1104801051 12:131555552-131555574 CGTGCCAGGCTGCGGGCAAGCGG + Intergenic
1104992735 12:132635241-132635263 CGGGCCAGGCTGTGGGTGAGTGG - Intronic
1106106343 13:26736704-26736726 CATGCCATGCTGGTGGTTAGAGG + Intergenic
1112340139 13:98546230-98546252 GGTGCCATGCTGTGTGCTAGTGG - Intronic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1113883930 13:113647447-113647469 CATGCCATGCTGAAGGTCAGAGG - Intergenic
1117205941 14:53443665-53443687 GGTGGGAAGCTGAGGGTTAGTGG + Intergenic
1120528601 14:85606237-85606259 CATGACATACTGAGTGTTAGCGG - Intronic
1122883698 14:104701216-104701238 CGTGCCATGCTGAGGGTTAGGGG - Intronic
1126518332 15:49559257-49559279 CCTGCCCTGATGAGGGTTAATGG - Intronic
1126907926 15:53387257-53387279 GGTGCCTTGCTGAGGGTCTGTGG - Intergenic
1132904866 16:2277456-2277478 CGTATCAGGCTGAGTGTTAGGGG + Intronic
1132995496 16:2820416-2820438 AGTGCCTTGCTGGGGGTCAGCGG + Intronic
1136025049 16:27463650-27463672 GGTACCATGCTGAAGGTTGGAGG - Intronic
1147328103 17:39679739-39679761 AGTGCCAGGCTGAGGGCTAGGGG - Intronic
1149468637 17:56898923-56898945 CGTGCAATGCTGATGGACAGCGG + Intronic
1151651401 17:75472266-75472288 TGAGCCATGCTGAGGGCTATTGG + Intronic
1152232117 17:79119056-79119078 AGAGCCCTGCAGAGGGTTAGAGG - Intronic
1152584862 17:81184381-81184403 CATGCCAGGCTGAGGGCTGGAGG - Intergenic
1152681836 17:81672481-81672503 CCTGCCAGGCTGAGGGAGAGAGG - Exonic
1161341740 19:3746776-3746798 CGTGCCATTCAGAGGGATGGTGG - Exonic
1164582698 19:29444467-29444489 TATGCGATGCTGAGGTTTAGGGG + Intergenic
1165648873 19:37468795-37468817 CGTGCCAGGCTGAGGGTAGCGGG + Intronic
931089469 2:58869833-58869855 CTTGCAATCCTGAGGGTGAGGGG + Intergenic
935156598 2:100488695-100488717 CATGCCATGCAGAGGGGTAGAGG - Intergenic
936166388 2:110123759-110123781 CGTGGGAAGCTGAGGGCTAGAGG + Exonic
940439922 2:153702333-153702355 TGGGGCCTGCTGAGGGTTAGGGG + Intergenic
940984313 2:160037470-160037492 AGTGACATGCTGAGGGCTGGGGG + Intronic
946152671 2:217787098-217787120 TGTGCCTTGCTCAGGGTTTGTGG - Intergenic
946309924 2:218877786-218877808 CTTACCTTGCTGAGGGTTGGTGG + Intergenic
948246520 2:236490365-236490387 TGTGCCATGTTGAAGGGTAGTGG - Intronic
948873585 2:240816005-240816027 GGTGCCAATCTGAGGGGTAGGGG + Intronic
948969633 2:241415028-241415050 CATGCCATGATGTGGGTTTGAGG - Intronic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1175178456 20:57128072-57128094 CTTGCCACCCTGGGGGTTAGAGG + Intergenic
949510282 3:4761195-4761217 TGTGCGATGCTGAGGTTTGGGGG + Intronic
965389695 3:168090152-168090174 TGGGCCATCCTGAGTGTTAGAGG + Intronic
966939326 3:184735520-184735542 GGGGACATGCTGAGGCTTAGGGG - Intergenic
967142358 3:186571343-186571365 AGTGCCAGGCTGAGGTTGAGGGG + Intronic
984509958 4:180667763-180667785 CCTGCCATGCTCAGGTATAGAGG + Intergenic
989652025 5:43701165-43701187 TGTGGGATGCTGAGGGTTGGAGG + Intronic
994149396 5:96431552-96431574 CGTGCCAGGCTCCGTGTTAGGGG - Intronic
994271212 5:97779161-97779183 TGTGTGATGCTGAGGTTTAGGGG - Intergenic
995565919 5:113433294-113433316 CGGGCCAGACTGAGGGTCAGGGG - Exonic
1002817547 6:693901-693923 CGTGGGATGCTGGGGGTTGGGGG + Intergenic
1003124580 6:3346268-3346290 CGTGCAATGCTGGGTTTTAGAGG - Intronic
1006205336 6:32336443-32336465 TGTGTGATGCTGAGGTTTAGGGG - Intronic
1007837150 6:44682507-44682529 AATGCTATGCTGTGGGTTAGGGG - Intergenic
1010501093 6:76601331-76601353 CGGGGCCTGCTGAGGGGTAGGGG + Intergenic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1018617884 6:165705073-165705095 CGTGCCATGCTGGGGGCGGGTGG - Intronic
1019444947 7:1066397-1066419 CGGGCCATGCTGAGGGACAGGGG + Intronic
1026979046 7:74515986-74516008 TGTGCCATGCTCAGGGTGATGGG - Intronic
1031886632 7:127251826-127251848 CGTGTCCTGCTGGGGGTTGGGGG - Intronic
1032540280 7:132697316-132697338 CGTGCCTTGCTGGGGATTTGTGG - Intronic
1034061243 7:148092542-148092564 CCTGCCCTGCTGGGGGTTAGAGG + Intronic
1034265891 7:149780488-149780510 TGAGCCATGCTGGGGGTTGGTGG + Intergenic
1041988155 8:63952241-63952263 CTTGCCATGCTGAGGGGAAGTGG + Intergenic
1048779146 8:137982286-137982308 TGAGCCATACTGAGGGTTAGTGG + Intergenic
1049289723 8:141795373-141795395 CCTCCCATGCTGAGGGTCTGAGG - Intergenic
1052762269 9:32604665-32604687 CCTGCCATGCAGATAGTTAGTGG - Intergenic
1057829752 9:98397373-98397395 CGTGCCAGGCTCTGGGCTAGGGG + Intronic
1059828320 9:118059466-118059488 CGTGCCATTCTGAGGATTGAGGG - Intergenic
1060768785 9:126315113-126315135 TGTCCCAGGCTGAGGGCTAGTGG - Intergenic
1185729425 X:2449341-2449363 CCTGCCATGGTGTGTGTTAGGGG - Intronic
1185730820 X:2460268-2460290 CCTGCCATGGTGTGTGTTAGGGG - Intronic
1185733764 X:2481815-2481837 CCTGCCATGGTGTGTGTTAGGGG - Intronic