ID: 1122884031

View in Genome Browser
Species Human (GRCh38)
Location 14:104702645-104702667
Sequence CTGGGGAGACGGGCTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122884031_1122884037 -8 Left 1122884031 14:104702645-104702667 CCATTCTCAGCCCGTCTCCCCAG 0: 1
1: 1
2: 5
3: 38
4: 383
Right 1122884037 14:104702660-104702682 CTCCCCAGCCTGGGCCTGGCAGG 0: 1
1: 0
2: 10
3: 92
4: 658
1122884031_1122884043 4 Left 1122884031 14:104702645-104702667 CCATTCTCAGCCCGTCTCCCCAG 0: 1
1: 1
2: 5
3: 38
4: 383
Right 1122884043 14:104702672-104702694 GGCCTGGCAGGGCCCCTCTATGG 0: 1
1: 0
2: 3
3: 20
4: 233
1122884031_1122884038 -7 Left 1122884031 14:104702645-104702667 CCATTCTCAGCCCGTCTCCCCAG 0: 1
1: 1
2: 5
3: 38
4: 383
Right 1122884038 14:104702661-104702683 TCCCCAGCCTGGGCCTGGCAGGG 0: 1
1: 0
2: 9
3: 74
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122884031 Original CRISPR CTGGGGAGACGGGCTGAGAA TGG (reversed) Intronic
900319493 1:2075550-2075572 CTAGGAAGACGGTCGGAGAAGGG - Intronic
900925680 1:5704867-5704889 CAGCCGAGACGGGCTGAGAAAGG + Intergenic
900985309 1:6069743-6069765 CTCGGGAGAAGGGATGCGAAGGG - Intronic
901102060 1:6726527-6726549 ATGTGGGGACAGGCTGAGAATGG - Intergenic
901252872 1:7795098-7795120 TGGGGGGGACGGCCTGAGAAAGG + Intronic
902543593 1:17172108-17172130 TTGGGGACAAGGGTTGAGAAAGG + Intergenic
902616407 1:17625857-17625879 CTGGGGAGAGGAGCCCAGAATGG + Intronic
902776025 1:18675574-18675596 TTGGGGGGACAGCCTGAGAAGGG - Intronic
903577714 1:24349189-24349211 CTGGGGAGACAGGCTGACACTGG + Intronic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904688987 1:32279757-32279779 CTGGGGAGGGGGGCTGGGCAAGG + Intronic
905279692 1:36841244-36841266 CTGGGAAGAAGGGATGAGCAGGG - Intronic
905309373 1:37038569-37038591 CTGGGGTGCCTTGCTGAGAATGG + Intergenic
905646388 1:39627309-39627331 ATGGGGAGACAGGCTCAGAGAGG - Intronic
905924794 1:41741688-41741710 ATGGGGCGTCGGGATGAGAAGGG + Intronic
906536948 1:46556325-46556347 CTGGGGAGGTGGGCTGAGAAAGG + Intergenic
907213415 1:52842603-52842625 CTGGGGAGGCGGGAGGAGAACGG + Intronic
907655251 1:56335484-56335506 CTGGGGATGCTGGCTCAGAAAGG - Intergenic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
908811732 1:67988379-67988401 CTGGGAAGAGGGGCTTAAAAGGG - Intergenic
909443738 1:75724914-75724936 GTGGGAAGTCGGGCTGAGGAAGG + Intronic
910354375 1:86339419-86339441 CTTGGGAGTGGGCCTGAGAAGGG - Intergenic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
910929184 1:92425684-92425706 CTGGGGAGATGAGGTGAGGATGG + Intergenic
912519174 1:110233688-110233710 CTGGGCAGACAGGCAGGGAAAGG + Exonic
915343389 1:155188286-155188308 CTGGGGAGAAGTGCTGTGATTGG + Intronic
915616650 1:157044519-157044541 AGGGGAAGAGGGGCTGAGAAAGG - Exonic
916724528 1:167510797-167510819 GTGGGGAGGAGGGCTCAGAATGG - Intronic
918265587 1:182839189-182839211 CTAGGGAGATGGGCTGAGCCGGG - Intergenic
919892996 1:201989710-201989732 CTGGAGAGAGGGAGTGAGAAAGG - Intronic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
920516636 1:206589328-206589350 CGGGGGAGAGAGGGTGAGAATGG + Intronic
920549061 1:206843104-206843126 CTGGGTAGAGAGGCTGAAAAGGG + Intergenic
920804876 1:209223607-209223629 CTGGGGAATGGAGCTGAGAAAGG - Intergenic
921906310 1:220498797-220498819 CTGGAAAGACAGGCAGAGAAAGG - Intergenic
1062863503 10:829161-829183 GAGGGGAGACGGGCTGTGCAAGG + Intronic
1063440335 10:6067780-6067802 CTGAGGAGAGTGGCAGAGAAAGG + Intergenic
1063957390 10:11280122-11280144 CCTGGGAGAGGGGCTGAGATGGG + Intronic
1065087651 10:22195972-22195994 CAGAGGAAATGGGCTGAGAAAGG + Intergenic
1065169102 10:23010161-23010183 CTGGAGAGAAGGGAAGAGAAGGG - Intronic
1065521557 10:26578758-26578780 CTGGGGAGAAGTGCTAAGATGGG - Intergenic
1065527377 10:26637011-26637033 CTGGGGAGAAGTGCTAAGATGGG - Intergenic
1065973551 10:30823712-30823734 CAGGGGAGACAGGCTGAGCTGGG - Intronic
1066201244 10:33144175-33144197 CTGGGGGGAGTGGCTGAGATAGG + Intergenic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1069890449 10:71649110-71649132 CTGGGGAGACTGGGAGAGGAAGG - Intronic
1071531689 10:86394607-86394629 CTGGCGAGACGGGCAGAAACAGG - Intergenic
1072268707 10:93754932-93754954 CTGGGGAGAGGGGCTTGGAAAGG - Intergenic
1073631481 10:105154270-105154292 CTGTGGTGAGGGGCTGAGGAAGG - Intronic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075688595 10:124380375-124380397 CTGGGGAGTCGGGAGGAGCACGG - Intergenic
1075808018 10:125204055-125204077 GTGGGGAGAGAGGTTGAGAAGGG - Intergenic
1076005012 10:126941852-126941874 CTGCAAAGGCGGGCTGAGAAAGG - Intronic
1077181361 11:1218661-1218683 GTGGGGAGACAGGCAGAGAAGGG + Intergenic
1077530542 11:3092801-3092823 CCTAGCAGACGGGCTGAGAAGGG - Intronic
1078334794 11:10455134-10455156 CTGGGGAGAAGAGCTCAGGAAGG - Intronic
1078708034 11:13764213-13764235 CTGGGGAGTGGGGCAGAGGATGG - Intergenic
1080325523 11:31067853-31067875 CTGGGGAGGCGGGCAGACAGAGG + Intronic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1081605576 11:44525320-44525342 CCGGGGAGACTGGCTGTGACTGG - Intergenic
1082780903 11:57286876-57286898 CTGGGCAGAAGGGCAGAGGAGGG - Intergenic
1082847574 11:57739052-57739074 CTGGGCAGAGGGTCTGAGCAGGG + Intronic
1083746904 11:64741946-64741968 CTGGGCAGAGGGGCTGCGCATGG + Intronic
1083888821 11:65585638-65585660 CCGGGAAGATGGGCAGAGAACGG + Intronic
1084490932 11:69477934-69477956 CAGGGGCCACGGGCTCAGAAGGG - Intergenic
1084595996 11:70117467-70117489 CTGGGGAGCCTGGGTGGGAAGGG - Intronic
1084890344 11:72233632-72233654 CTGGGGAGAGGGGATAGGAATGG - Intronic
1085061889 11:73454830-73454852 GTGGGAAGAGGGGCTGAAAAGGG - Intronic
1085088701 11:73691196-73691218 CTGGGGTGAGGGGCTGCCAAGGG + Intronic
1085510955 11:77087977-77087999 CTGGGGAGATGCACGGAGAATGG + Intronic
1085721087 11:78912976-78912998 TTGGGGAAACGGGCTCAGATAGG - Intronic
1085732295 11:79010299-79010321 GCGGGGAGAAGGGCTGTGAAGGG + Intronic
1086131747 11:83408695-83408717 GTGGGGAGAGTGGCGGAGAAGGG + Intergenic
1087797238 11:102467343-102467365 CTGGTGAGATGAGCTGAAAATGG + Exonic
1089297960 11:117481133-117481155 CTGGGGAGGTGGGATGGGAAGGG + Intronic
1089406487 11:118201880-118201902 TTGGGGAGATGGGCTGAGGAGGG + Intronic
1089528917 11:119114000-119114022 CTGGGGAGAGGAGCTGGGATGGG + Intronic
1090214222 11:124946765-124946787 CTTGGGAGACAGGCTGAAAGTGG + Intergenic
1091191424 11:133698649-133698671 CAGGGGAGCCTGTCTGAGAATGG - Intergenic
1091669158 12:2440003-2440025 CTGGGAAGAAGGGCTGGGCAGGG - Intronic
1092211777 12:6651052-6651074 GTGGGGAGAGGGGAGGAGAAGGG + Exonic
1092910615 12:13141756-13141778 CTCAGGAGCAGGGCTGAGAATGG + Intronic
1094700270 12:32863053-32863075 CTGTGGAGACCGGCTAGGAACGG + Intronic
1095955345 12:47802703-47802725 CTGGGGGGACAGGAGGAGAAAGG + Intronic
1096750642 12:53756753-53756775 CTGGGGAGGGGGGATGAGATGGG + Intergenic
1099891036 12:88588537-88588559 GTGGGGAGAGGGGCTTAAAAAGG + Intergenic
1101041412 12:100759737-100759759 ATGGGGAAACGGGCTCAAAATGG - Intronic
1101930313 12:109008373-109008395 CTGGGGAGATGGGGTGTGAGGGG + Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102468192 12:113142761-113142783 CTGGGGAGTGGGGCTGAGGCAGG - Intergenic
1103358815 12:120341953-120341975 CTGGGGTGAGGGGCTGCCAAGGG + Exonic
1103452644 12:121040108-121040130 CTGGGGATCCGGGCTGGGCATGG + Intergenic
1103984503 12:124758419-124758441 CTGGGGAGCCGGGCTAATGATGG - Intergenic
1104109935 12:125695382-125695404 CTGGGGAGAGGCCCTGAGCAAGG - Intergenic
1105661329 13:22498542-22498564 TTGAGGAGACGGGGTGGGAAGGG + Intergenic
1108158186 13:47610141-47610163 CTAGGGAGAAGGGGTAAGAAAGG + Intergenic
1108500279 13:51064058-51064080 CTGGGCTGACTGGGTGAGAAAGG - Intergenic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108732454 13:53248875-53248897 TTGGGGTGAGGGGCTGAGAAGGG - Intergenic
1110868155 13:80420467-80420489 GTGGGGAGAAGGGGGGAGAAGGG - Intergenic
1111466662 13:88622353-88622375 CTCGGGAGAAGGACAGAGAAGGG + Intergenic
1112064418 13:95777343-95777365 CAGGGCAGCCTGGCTGAGAATGG - Intronic
1114229096 14:20764353-20764375 CTGGGGAGAGGGGCTTACAAAGG - Intergenic
1115876626 14:37868684-37868706 CTAGGGAGGAGGGCTGGGAATGG + Intronic
1116895330 14:50310589-50310611 TTGGGGAGGGGGGCTGAGGAGGG + Intronic
1118617187 14:67582092-67582114 AAGGGGAGACGGACCGAGAACGG + Exonic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1120286545 14:82509462-82509484 TTGAGGATACGGGATGAGAAAGG + Intergenic
1120640528 14:87005905-87005927 CTGGGGAGACTGGGTGAGACTGG - Intergenic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121154998 14:91674919-91674941 CTGGGGAGAGGAGTTTAGAAGGG - Intronic
1122112830 14:99514007-99514029 CTGAGGACACGGGCTCAGAGTGG + Exonic
1122324786 14:100875634-100875656 TTGGGGAGGAGGGGTGAGAAAGG - Intergenic
1122624764 14:103078873-103078895 CTGGGGAGCAGGGCTGGGAGAGG + Intergenic
1122744441 14:103889591-103889613 CTGGGGCAAAGGGCTGAGATTGG + Intergenic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1126557335 15:50004031-50004053 CTGGGGAGATGGGCGGAGGTGGG - Intronic
1128455265 15:67828204-67828226 CTGCGGGGCCGGGCGGAGAACGG + Intronic
1128731974 15:70027295-70027317 CTGGGGACACCGGCTGGGCAGGG - Intergenic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129112006 15:73342642-73342664 CTGGGGAGAGGGACAGGGAAAGG - Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130895624 15:88168407-88168429 CTGGGGATCAGGGCTGGGAAAGG + Intronic
1131108424 15:89749967-89749989 ATGGAGGGAGGGGCTGAGAAGGG + Exonic
1132177883 15:99729588-99729610 CTCGGAAGACGGGCTCAGAAGGG + Exonic
1132570696 16:642691-642713 CTGGGGTGAAGGGCGGAGGAGGG - Intronic
1132600505 16:770672-770694 CTGGGGGGACGGGGTGAGGGGGG + Intronic
1132600546 16:770764-770786 CTGGGGGGACGGGGTGAGGGGGG + Intronic
1132793122 16:1704803-1704825 CTGGGGACACTGGCTCAGAATGG + Intergenic
1133204278 16:4223776-4223798 CTGGGAAGATGGGCTTAGATTGG - Intronic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134843806 16:17423238-17423260 CTGGGGAGGCCTGCCGAGAAGGG - Intronic
1135183172 16:20292381-20292403 CTGGGGAGCAGGGGAGAGAATGG - Intergenic
1137451089 16:48574908-48574930 CTGGCAAGACTGGCAGAGAAAGG + Intronic
1137861842 16:51854722-51854744 CTGGGGTGAGGGGCTGGGCATGG + Intergenic
1139139259 16:64241366-64241388 CTGGGGAGTCTGGCTGAGCTCGG - Intergenic
1139371424 16:66471757-66471779 CTGGGGAGACTTGCAGAGACTGG - Intronic
1139429057 16:66901321-66901343 CTGGGCAGCAGGGCTGGGAATGG + Intergenic
1140060437 16:71564812-71564834 CAGGGTAGACAGGCTGAAAAAGG + Intronic
1140304802 16:73793019-73793041 TTTGGGAGACGGGGAGAGAAGGG + Intergenic
1141984594 16:87571613-87571635 CTGGGGAGGCAGGGTGGGAAAGG + Intergenic
1142429489 16:90018822-90018844 CAGGGGCGAGGGGCTGAGATGGG - Intronic
1142470542 17:161101-161123 CTGGGGAGATGGGGAGAGATGGG - Intronic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143013777 17:3880962-3880984 CTGGGGAGAGGGGCAGGGAGTGG - Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143314719 17:6023650-6023672 CTGCAGAGACTGGCTGTGAAGGG + Intronic
1143704572 17:8687637-8687659 CGGGGGAGAGGGGGTGGGAAGGG - Intergenic
1143712668 17:8745029-8745051 CTGGTGAGTGTGGCTGAGAAGGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1145004265 17:19328644-19328666 CTGGGCAGCTGGGGTGAGAAGGG - Intronic
1145263110 17:21366324-21366346 CTGGGGAGCCTGGCTGGGAGGGG + Intergenic
1146286306 17:31576349-31576371 GTAGGGAGACCTGCTGAGAATGG - Intergenic
1146481325 17:33207130-33207152 CTGAGGAGAAGGGCTTATAAAGG + Intronic
1146639791 17:34531573-34531595 CTGGGGAGTAGGGCTGTGTAAGG - Intergenic
1146762539 17:35490999-35491021 CTGGGGAGGCCGGAGGAGAAAGG - Intronic
1146957364 17:36943262-36943284 CTGGGGAGACCGGATGGAAAAGG + Exonic
1148690638 17:49524980-49525002 CTGGGGTGAGGGGCTGGGAGTGG - Intergenic
1148742487 17:49900741-49900763 CTGGGTACATGGGCAGAGAAGGG - Intergenic
1148853214 17:50564816-50564838 CTGGGGAGAAGGGCTGGGGCTGG + Intronic
1148862858 17:50613551-50613573 CTGGGGTGACGGGGAGAGGAGGG + Intronic
1151627816 17:75288579-75288601 ACAGGGAGAAGGGCTGAGAAGGG + Intronic
1151826722 17:76527902-76527924 GTGGGGAGCTGGTCTGAGAAGGG + Exonic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152199020 17:78934472-78934494 CTGGGGAGAGGGGAGGAGAGAGG - Intergenic
1152938251 17:83152893-83152915 CCGTGGAGATGGGCCGAGAATGG + Intergenic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1153942756 18:9991713-9991735 CGGGGCAGAGAGGCTGAGAAGGG - Intergenic
1154308135 18:13245283-13245305 ATGGGGAGACGAGGTGAGACAGG + Intronic
1155200828 18:23516170-23516192 CTGGGCAGACAGGCTGTGAGAGG + Intronic
1156463276 18:37333541-37333563 CTGTGGGGAAGAGCTGAGAATGG + Intronic
1156489319 18:37486950-37486972 CTGTGGAGACTGGCTGGGGATGG - Intronic
1157557373 18:48621639-48621661 CAGGTAAGAGGGGCTGAGAATGG + Intronic
1157944286 18:51961033-51961055 CTGGAGAGAGGGGCTCAAAAAGG - Intergenic
1158452310 18:57578198-57578220 GTGGGGAGAGGGGCTGGGAGGGG + Intronic
1158668862 18:59456743-59456765 CTGGGCAGTCGGGCTGTGTAAGG - Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1160425523 18:78776351-78776373 CAGAGGAGAGGGGCAGAGAAGGG + Intergenic
1160989908 19:1856254-1856276 CTGGGGAGCCCAGCTGAGGAGGG + Intronic
1160999719 19:1904481-1904503 CTGGGGTGAGGGGCTAAAAAAGG - Intergenic
1161235166 19:3194022-3194044 TGGGGGAGCAGGGCTGAGAAGGG + Intronic
1161398775 19:4058627-4058649 CTGGGGAGAGGGCCTGAGCTGGG + Intronic
1161684094 19:5694610-5694632 GTGGGGTGACGGGCACAGAAAGG + Intronic
1162796611 19:13090542-13090564 CTGGGGAGACAGGCTCAGCTGGG - Intronic
1163261269 19:16191563-16191585 TTTGGGAAACGGGCTCAGAAAGG - Exonic
1164698607 19:30265570-30265592 CTGGGGAGACGCACTCAGAAAGG + Intronic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1164841162 19:31393349-31393371 CTGGGGAGAGAGGCTCAGACGGG + Intergenic
1165253066 19:34556089-34556111 TTGGGGTGACTGGCTCAGAATGG + Intergenic
1165311616 19:35031977-35031999 CTGTGGAGAGGGGCTGAGTGTGG + Intronic
1165772994 19:38389187-38389209 CGGGGGAGGCGGGCGGACAAAGG + Intronic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1165795927 19:38519133-38519155 TTTGGGAGTCGGGCTGGGAACGG + Intronic
1165811449 19:38614293-38614315 CTGGGGAGAAGGGTGGACAAGGG + Intronic
1165893401 19:39127833-39127855 ATGGGGAGGAGGGCTGGGAATGG + Intronic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1167074578 19:47240673-47240695 CTGGGGAAAAGGGCTCAGAGGGG - Intergenic
1167240255 19:48339154-48339176 CTGGGAAGAGGGCCTGAGCAGGG + Intronic
1168096332 19:54117333-54117355 CTGGGGAGAGGGGCTTAAAAAGG + Intronic
925583373 2:5437516-5437538 CTGAGGAGTCTGGCAGAGAATGG - Intergenic
926743798 2:16134172-16134194 CTGGGCAGTCTGGCTGAGCATGG + Intergenic
926758225 2:16252919-16252941 GTGGGGAAACAGGCTGAGAGAGG + Intergenic
927881400 2:26692571-26692593 CTGGGGAGACGCGCCGAGGAGGG - Intergenic
927944806 2:27129262-27129284 AAGGGGAGAGGGGCTAAGAAGGG + Intronic
927946687 2:27138908-27138930 CGGGGGATAAGGGCTGAGATGGG + Intronic
930263591 2:49174426-49174448 CAGGGGAAAGGTGCTGAGAATGG + Intergenic
930880352 2:56263468-56263490 CTGAGCAGACAGGCAGAGAAGGG - Intronic
932440028 2:71728883-71728905 CTGGGGAGAGGGGCTGGGCTGGG - Intergenic
933737516 2:85507113-85507135 GTGGGGAGCGGGGCTGAGAGAGG + Intergenic
934517297 2:94996707-94996729 CTGGGGAGAGGAGCTGGGGATGG + Intergenic
934553740 2:95276894-95276916 CTGGGGAGGCAGGATGGGAATGG + Intronic
936941850 2:117891633-117891655 CTGGGGAAACGGGCTTAGACAGG + Intergenic
937036745 2:118788474-118788496 GTGGGGAGAGGGGCAGAGATGGG - Intergenic
937043552 2:118838701-118838723 CAGGGGAGCAGGGCAGAGAAGGG - Intergenic
937316316 2:120934014-120934036 CTGGGGCCAGGGCCTGAGAATGG - Intronic
937916294 2:127100677-127100699 CTGGGGAGCCGAGGAGAGAAAGG - Intronic
939991646 2:148881646-148881668 ATGGGAAGAAGAGCTGAGAATGG - Intronic
940167185 2:150787214-150787236 CTTGGAAGACTGGCTGACAATGG - Intergenic
940382879 2:153036198-153036220 CTTGGGAGACTGGCTCACAATGG - Intergenic
942075604 2:172354636-172354658 CTGAAGAGAGGGGCTGAGTATGG - Intergenic
944193080 2:197024031-197024053 GTGGGGAGACAGGCAGTGAAAGG + Intronic
944553895 2:200869301-200869323 CTGGGGAGAGGTGCTTAAAAAGG - Intergenic
944708183 2:202311897-202311919 GTGGGGAGACGGGGTTACAAGGG - Intergenic
944755501 2:202757332-202757354 TTGGGGACACGGACTGGGAACGG - Exonic
944894053 2:204145980-204146002 CTGGGGAGACGGGCCGGGGAGGG - Intergenic
944987612 2:205195463-205195485 CTGGGGAGAAGGGATCAAAATGG - Intronic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
945894488 2:215466817-215466839 CTGGGAGGAGGGGTTGAGAAAGG + Intergenic
946408473 2:219505106-219505128 CTGGAGAGAGGGGCTTAGAGAGG + Intronic
947533784 2:230928425-230928447 CTGGGGAAATGGGCTCAGAGAGG - Intronic
947611576 2:231528087-231528109 CTGGGAAGAGGGGCTGAGCCAGG - Intronic
948689359 2:239692152-239692174 CTGGAGAGAAGCGCTGAGCAGGG + Intergenic
1168926638 20:1587138-1587160 ATGGGGAGGCAGGCTGAGAGAGG - Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1170455979 20:16533151-16533173 CTGGGATGACTGGCTGGGAAGGG + Intronic
1170717195 20:18842181-18842203 CTGGGGAAATGGTCTGGGAAGGG - Intergenic
1172275977 20:33679631-33679653 CTGGGGAAACGGGCTCAGAGAGG - Intronic
1172766368 20:37353276-37353298 CTGAGGAGACGGGCTCAGTGGGG - Intronic
1173229222 20:41181063-41181085 CTGGGCAGGCTGGCTGAGAGAGG + Exonic
1173364572 20:42373193-42373215 CTGAGGAGACAGGCTCAGAGAGG + Intronic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1173854871 20:46243670-46243692 CAGGGGAGATGGGATGAGAGGGG + Intronic
1174117466 20:48236885-48236907 CTGGGGGGATGGGCTGAGAGTGG + Intergenic
1174192480 20:48750123-48750145 CAGAGGAGAGGGGCTGAGGACGG - Intronic
1174991539 20:55515907-55515929 CTGGGGACATAGGCTGTGAAAGG + Intergenic
1175767880 20:61603622-61603644 CTGGGCAGACGGGGTGGGCATGG - Intronic
1175838930 20:62014489-62014511 GTGGGGAGAGGGGCTGGGCAGGG + Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1175989138 20:62778871-62778893 ATGGGGAGAGGAGCTGAGGATGG + Intergenic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176292839 21:5055376-5055398 CTAGGGAGACGGGCTTGGAGGGG - Intergenic
1177149318 21:17438844-17438866 CTTGGGGGAAGGGCTGAGCATGG - Intergenic
1178670876 21:34590685-34590707 CTGGGGCCAGGGACTGAGAAAGG + Intronic
1178916763 21:36709294-36709316 CTGGGGTGGCGGGGTGGGAAGGG - Intronic
1179205527 21:39273639-39273661 ATGGGGGGACAGGCTGAGATGGG + Intronic
1179551495 21:42146597-42146619 CTGGGGAGGAGGGCTGAGGTTGG + Intergenic
1179641014 21:42747288-42747310 CTGGGGAGAGGAGCTGCAAAAGG + Intronic
1179864421 21:44208274-44208296 CTAGGGAGACGGGCTTGGAGGGG + Intergenic
1179891204 21:44335927-44335949 CTGGGCACACTGGCTGAGTAAGG - Intronic
1179891219 21:44335979-44336001 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891235 21:44336031-44336053 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891251 21:44336083-44336105 CTGGGCACACTGGCTGAGCAGGG - Intronic
1179891267 21:44336135-44336157 CTGGGCACACTGGCTGAGCAGGG - Intronic
1180083446 21:45497114-45497136 CTGGGGACACAGGCTCTGAAGGG + Intronic
1180748920 22:18111136-18111158 CTGGGGAGCCCGACGGAGAAGGG + Intronic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1181038178 22:20179786-20179808 CTGGGCAGAGGGGCAGGGAAGGG - Intergenic
1181342831 22:22196338-22196360 CGGTGGAGACAGGCTGAGACTGG - Intergenic
1181390972 22:22580444-22580466 GAGGGGAGAGGGGCTGAGAGTGG - Intergenic
1181520752 22:23448269-23448291 CTGGGGATGCGGGGTGAGGAGGG - Intergenic
1182017046 22:27049439-27049461 CTGAGGACTAGGGCTGAGAAGGG - Intergenic
1183174265 22:36211292-36211314 CTGGAGAGAGGGGTTTAGAAAGG - Intergenic
1184406215 22:44302461-44302483 CTGGGGAGTGGTGCCGAGAATGG + Intronic
1184932661 22:47692794-47692816 CTGTGGAGGCGGGCTCTGAACGG - Intergenic
1185019045 22:48362893-48362915 CTGGGGAGAGGCGGTGGGAAAGG + Intergenic
1185326299 22:50227436-50227458 CAGGGGAGCTGGGCTGTGAAGGG - Intronic
1185348281 22:50320099-50320121 CTGGGCAGATGGGATGAGGAGGG - Intronic
949583106 3:5410754-5410776 TTCGGGAGACTGGCAGAGAAAGG + Intergenic
950011685 3:9728737-9728759 GGGGGGAGAGGGGCTGATAAGGG - Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
951698448 3:25469926-25469948 CTGTGGAGAGGGGCTTAAAAAGG + Intronic
952407985 3:33022218-33022240 CTGGGCATTGGGGCTGAGAATGG - Intronic
952865782 3:37854304-37854326 CTGGGGAGCCTGGCTGAGAGAGG + Intergenic
953321369 3:41975184-41975206 CTGGGTAGAAGAGGTGAGAAGGG - Intergenic
953851640 3:46469596-46469618 CTGAAGAGAGGGGCAGAGAATGG + Intronic
953923337 3:46967176-46967198 CAGGGGAGAGGGGCTTTGAAGGG - Intronic
954956565 3:54526541-54526563 TTGGGAAGAGGGGCAGAGAAGGG - Intronic
956386837 3:68728642-68728664 CTGGGGAGAAGGGCTTAAAGAGG + Intergenic
960697139 3:120407237-120407259 CAGAGGAGATGGGCTGAGACAGG + Intronic
961812447 3:129529653-129529675 CTGAGGACAGGGGCTGAGAGGGG - Intronic
961873530 3:130004258-130004280 CTGGGGAGCCCGGGGGAGAAGGG + Intergenic
963084171 3:141421682-141421704 GTGGGGTGAGGGGCTGAGGACGG - Intronic
965478228 3:169184390-169184412 CTAGGGTGAGGGGCAGAGAAAGG + Intronic
966775940 3:183542637-183542659 CTGGGGACAGGGGCTGTGAGAGG - Intronic
968700065 4:2051499-2051521 CTGGGGTGACGGGCTGATCACGG + Intergenic
968808753 4:2790763-2790785 CTGGGGAAAGGGGCAGAGACCGG - Intergenic
969125122 4:4941829-4941851 CAGGGGAGCCTGGCTGAGCATGG - Intergenic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
970891023 4:21044598-21044620 CAGGGGAAACGGGCTGGGCATGG - Intronic
971234686 4:24830174-24830196 CTGTGGTGACCTGCTGAGAATGG + Intronic
974611701 4:64226900-64226922 CTAGGGAGAAGGACAGAGAAAGG - Intergenic
975592085 4:76010889-76010911 CTGCGGACACGGGCTCAGCAAGG - Intergenic
978030127 4:103931027-103931049 CTAGGGAGACTGGCTTAGCAGGG - Intergenic
979478850 4:121190550-121190572 CTGGGAAAAGGGGCTGACAAAGG + Intronic
979486032 4:121271423-121271445 CTGGGTAGACAAGCTGACAAAGG + Intergenic
981657110 4:147124432-147124454 CTGTGGAGTGGTGCTGAGAACGG - Intergenic
982292254 4:153791479-153791501 CTGGGGAGGCGCGCTGGGATGGG - Intergenic
983176164 4:164590320-164590342 CTGGGGAGAGGAGGTTAGAAAGG + Intergenic
984065100 4:175037922-175037944 CTCGGGAGAAGGACAGAGAAAGG + Intergenic
984559011 4:181246489-181246511 CAGGGGAGACTGGCTGTGATAGG + Intergenic
984845874 4:184107283-184107305 CTGGGGTGACGGGCTCAGGCTGG + Intronic
985009649 4:185569254-185569276 CTGGGGAGACTGCCTGAAGAGGG + Intergenic
985317453 4:188673015-188673037 CTGGGGAGAGGGGCAGAGGTGGG + Intergenic
985731580 5:1552294-1552316 CTCGGGAGAGGGACTGAGAGGGG + Intergenic
985991271 5:3563866-3563888 CTGGAGAGGCGGGCTGGGTAGGG + Intergenic
988594971 5:32582948-32582970 CTGGGAAGTAGGGCTGAGAAGGG - Intronic
989144770 5:38238000-38238022 CTGGGGAAAGTGGTTGAGAAGGG - Intergenic
989786275 5:45335161-45335183 CTTTGGAGACAGGCTCAGAAGGG + Intronic
990700701 5:58472259-58472281 CTGGGGAGGCTGGCCGAGACAGG + Intergenic
991246987 5:64519135-64519157 CTGGGGAGACCGGAAGAGTATGG + Intronic
992080708 5:73232967-73232989 ATGGGGAGGAGGGCAGAGAAGGG - Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
993596989 5:89869684-89869706 CTGGGGAGAAGGGCTAGGTATGG - Intergenic
994438463 5:99769224-99769246 CTTGGGAGAAGGACAGAGAAGGG + Intergenic
995131065 5:108631076-108631098 CTTGGGAAAGGGGCTGTGAAAGG - Intergenic
996404993 5:123095470-123095492 CTGGGGAGCCGGGCAGAGGGCGG - Intronic
997554935 5:134787907-134787929 GTGGGGGGAGGGGCTGAGATGGG + Intronic
997642292 5:135457147-135457169 CTGGGGATACGGGCTGTCAGAGG + Intergenic
998586246 5:143430853-143430875 CTGAGGAGGCAGGCTGTGAAGGG - Intronic
998671238 5:144356718-144356740 GTGGGGAGAAAGGCTGGGAAAGG + Intronic
1000166766 5:158657352-158657374 CTAGGGAGACAGGGTTAGAATGG - Intergenic
1001056683 5:168455472-168455494 CTGGGGAGAAGGTCTTAGAGCGG - Exonic
1001135466 5:169099093-169099115 CTGGGGAGAGGGGCTGGGGTAGG - Intronic
1002445613 5:179288282-179288304 CTGGGCAGGCGGGCAGAGGACGG - Intronic
1003137747 6:3446204-3446226 CATGGGAGAGGGGCTGGGAAGGG - Intronic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1003567094 6:7230852-7230874 CAGGGAAGAAGGGCTCAGAAAGG - Exonic
1005766121 6:29014009-29014031 CTGGGAAGAGTAGCTGAGAAAGG + Intergenic
1005968161 6:30742109-30742131 CTGGGGTCACTGGCTGGGAAGGG + Intronic
1006147575 6:31968613-31968635 CTGAGGACAAGGGCTGAGATGGG - Intronic
1006717792 6:36131172-36131194 CTGGGCAGCTGGGCTGAGAGGGG - Intronic
1006916097 6:37594733-37594755 CTGGGGAGCTGGGCTGGGAGGGG - Intergenic
1007036405 6:38678467-38678489 CTGGGGAGAATGGGTGAGGATGG + Intronic
1007385215 6:41516049-41516071 CTGGGGGCAAGGGCTGGGAAAGG + Intergenic
1007521818 6:42455879-42455901 ATGGGGATAAGTGCTGAGAATGG - Intergenic
1007735992 6:43982485-43982507 ATGGGGAGAGCAGCTGAGAAGGG + Intergenic
1010126974 6:72443817-72443839 CTAGGGAGACGGGCTGTGATAGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1014348079 6:120300971-120300993 CTGGAGAGAAAGGCTGAAAATGG - Intergenic
1016257226 6:142122036-142122058 CTGAGGAGAGGGGCTTAAAAAGG - Intergenic
1017485735 6:154900561-154900583 CTGGGGAGCAGGGTGGAGAAAGG + Intronic
1018021841 6:159768385-159768407 CTGGGGAGAAGGGCTGCAAAGGG + Intronic
1018133621 6:160756493-160756515 CTGGGGAGATGGGTAGCGAAGGG - Intergenic
1019590487 7:1827978-1828000 CTGGGGATGCGGGGTGAGGAGGG + Intronic
1022339599 7:29455852-29455874 CTGAGGAGTGGGGCTGCGAAAGG - Intronic
1022723741 7:32962891-32962913 GTGGGGCGACAGGCTCAGAAAGG + Intronic
1023297127 7:38726989-38727011 CTGGCGAGGAGGGCAGAGAAAGG + Intronic
1024685254 7:51737708-51737730 CTGGGCAGACGGGCTGAGACAGG + Intergenic
1025834932 7:65085561-65085583 ATGGGGAAACGGGCTCAGAGAGG - Intergenic
1026597778 7:71748839-71748861 CTGGGGAGGCTGGCTGTGAGAGG - Intergenic
1026904726 7:74056453-74056475 CTGGGGACATGGGTTGAGAAGGG + Intronic
1027151743 7:75738587-75738609 CTGGGGAGAAGGGCAGAGGCGGG - Intronic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029568241 7:101353869-101353891 ATGGGGATATGGGCTGAGCACGG + Intergenic
1030178701 7:106682111-106682133 TTGGGCAGACGAGTTGAGAAAGG + Intergenic
1033435941 7:141333753-141333775 CTGGGGTGGAGGGCGGAGAATGG + Intronic
1034995220 7:155572661-155572683 CTGGGGAGATATGCAGAGAATGG - Intergenic
1035534358 8:379823-379845 GTGGGGAGATGGGCTGGGAGGGG - Intergenic
1035663504 8:1364125-1364147 CACGGGAGACGGGCTCAGGAGGG - Intergenic
1038349796 8:26765471-26765493 CTGGGGAGCTGGGCTGAGCCAGG - Intronic
1038672851 8:29596421-29596443 CTGGGCTGAAGTGCTGAGAAAGG + Intergenic
1038958360 8:32491600-32491622 CTGGGTAGTCTGGCTTAGAATGG + Intronic
1039318845 8:36405578-36405600 CTGGGGAATCAGGCTGAGAGAGG + Intergenic
1039427177 8:37495523-37495545 TTGGGAAGACGGGATGAGGAAGG - Intergenic
1039452679 8:37688325-37688347 CTTGGAAGACTGGCCGAGAAAGG + Intergenic
1042220816 8:66472236-66472258 CTGGGGAGTAGGTATGAGAAAGG + Intronic
1042939027 8:74089014-74089036 AGGGGGAGATGGGGTGAGAAGGG + Intergenic
1044004270 8:86922766-86922788 CTGGGTATAGGTGCTGAGAAGGG + Intronic
1044340888 8:91045054-91045076 GCGGGGAGGCAGGCTGAGAAAGG - Intergenic
1045001183 8:97879502-97879524 CCTGGGAGTCTGGCTGAGAAAGG + Intronic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1045347062 8:101302919-101302941 CTGGGAAGATGGGGTGAGGATGG + Intergenic
1047934295 8:129761727-129761749 ATGAGGAGAAGGGGTGAGAATGG - Intronic
1048005644 8:130417420-130417442 CAGAGGAAACGGGCTGACAATGG - Intronic
1048793793 8:138129592-138129614 CTGGGGTGACGGGCTGTGCAAGG + Intergenic
1048949239 8:139480478-139480500 CTGAGGAGACGGGAGGAGCAGGG + Intergenic
1049510299 8:143023944-143023966 CAGGGGAGACAGGCTCAGAGTGG + Intergenic
1052851214 9:33379667-33379689 CTGGGGAGATTGGCTCAGTAAGG - Intergenic
1053533554 9:38904824-38904846 GTGGGGCGAGGGGCAGAGAACGG + Intergenic
1053538558 9:38949794-38949816 CTGGGGAGAAAGGCTTAAAAAGG - Intergenic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1053810097 9:41843051-41843073 CTGGGGAGATGGGCTGGGCACGG - Intergenic
1054205779 9:62129253-62129275 GTGGGGCGAGGGGCAGAGAACGG + Intergenic
1054620496 9:67344377-67344399 CTGGGGAGATGGGCTGGGCACGG + Intergenic
1054627580 9:67414125-67414147 CTGGGGAGAAAGGCTTAAAAAGG + Intergenic
1054632582 9:67459117-67459139 GTGGGGCGAGGGGCAGAGAACGG - Intergenic
1056759447 9:89404786-89404808 CTGAGGTGAGTGGCTGAGAACGG - Intronic
1057517907 9:95737364-95737386 CTGGGGAGAGCAGCTGAGCAGGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058025316 9:100136727-100136749 CTGGGGAGATGGGAACAGAAAGG + Intronic
1058141796 9:101364197-101364219 CTTGGAAGAGAGGCTGAGAAAGG - Intronic
1058431602 9:104925718-104925740 CTTGGGAAACAGGCTGACAATGG + Intronic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059224103 9:112655672-112655694 CTGGAGAGAGGGGCTTAAAAAGG + Intronic
1059331334 9:113537495-113537517 CTGGGGAGAGGGGATGGGATAGG + Intronic
1060055970 9:120413385-120413407 TTGGGGAGCAGGCCTGAGAAAGG - Intronic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1061045810 9:128164283-128164305 CTGGGGAGACAGGCCAAGAGTGG - Intergenic
1061103209 9:128508292-128508314 CTGGGGAGACTGGTTGAGGTGGG + Intronic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062428362 9:136516346-136516368 CAGTGGAGCCGGGCTGAGAATGG + Intronic
1062612508 9:137381465-137381487 CTGGGCAGTGGGGCTGGGAAGGG + Intronic
1185892961 X:3836427-3836449 CTGGGGAGAGGGACTGGGACTGG - Intronic
1185898070 X:3874847-3874869 CTGGGGAGAGGGACTGGGACTGG - Intergenic
1185903189 X:3913278-3913300 CTGGGGAGAGGGACTGGGACTGG - Intergenic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1189110013 X:38279545-38279567 CTGGGGGGTGGGGCTGAGAGTGG + Intronic
1190048544 X:47132076-47132098 CTGGGGGGAGGGGGTGGGAAGGG - Intergenic
1190301195 X:49058611-49058633 CTGGGAAGAAGGGCTGAGAGTGG - Intronic
1194391870 X:93329003-93329025 CTGGAGAGTCTGCCTGAGAATGG - Intergenic
1195643753 X:107206143-107206165 CTGGAGAGACGGGGGCAGAAGGG - Intronic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1196995760 X:121381897-121381919 CTGGGGTGGGGGGCTGAGGAAGG - Intergenic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1200813436 Y:7507326-7507348 CTGGGGAGTGGGGCTGAGATGGG - Intergenic