ID: 1122884975

View in Genome Browser
Species Human (GRCh38)
Location 14:104706933-104706955
Sequence CCTGCAGCACCGACAGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122884975_1122884979 -8 Left 1122884975 14:104706933-104706955 CCAGCTCCTGTCGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 29
4: 262
Right 1122884979 14:104706948-104706970 GCTGCAGGGCCTCCTGCACCTGG 0: 1
1: 0
2: 14
3: 52
4: 511
1122884975_1122884989 25 Left 1122884975 14:104706933-104706955 CCAGCTCCTGTCGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 29
4: 262
Right 1122884989 14:104706981-104707003 CCGCTCCAGCCAGCTGCTCTGGG 0: 1
1: 1
2: 1
3: 23
4: 266
1122884975_1122884987 24 Left 1122884975 14:104706933-104706955 CCAGCTCCTGTCGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 29
4: 262
Right 1122884987 14:104706980-104707002 TCCGCTCCAGCCAGCTGCTCTGG 0: 1
1: 0
2: 4
3: 16
4: 219
1122884975_1122884990 28 Left 1122884975 14:104706933-104706955 CCAGCTCCTGTCGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 29
4: 262
Right 1122884990 14:104706984-104707006 CTCCAGCCAGCTGCTCTGGGAGG 0: 1
1: 0
2: 8
3: 36
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122884975 Original CRISPR CCTGCAGCACCGACAGGAGC TGG (reversed) Exonic
900123981 1:1061473-1061495 TCTGCAGCACCCACAGGTCCTGG - Intergenic
900471430 1:2856880-2856902 CCTGCAGCATCGGCCGCAGCTGG - Intergenic
901319797 1:8332877-8332899 CCTGCAACGCCCACAGGTGCAGG - Intronic
903070467 1:20724563-20724585 CTTGCAGCACCCTGAGGAGCGGG - Exonic
903543272 1:24108546-24108568 GCTGGAGCACCGGCAGGAGGAGG - Exonic
903555049 1:24187200-24187222 CCTGCAGCAGGCACAGGAGCAGG + Exonic
904893382 1:33795790-33795812 CCTGGCCCACCGACAGGAACTGG - Intronic
908242291 1:62197575-62197597 CCTGCTGCCCCGAAAGGTGCTGG + Intronic
909406031 1:75290528-75290550 CTGACAGCACTGACAGGAGCAGG + Intronic
911626828 1:100133358-100133380 GTTCCAGCACCGACAGGACCAGG - Intronic
913286731 1:117233442-117233464 TCAGCAGCACCCCCAGGAGCTGG - Intergenic
913985853 1:143565423-143565445 ACTGCAGCTGCGACAGCAGCTGG + Intergenic
914779368 1:150770973-150770995 GCAGCAGCACCAGCAGGAGCAGG + Intergenic
915034401 1:152910283-152910305 CCTGAAGCACCTAGAGCAGCAGG + Exonic
915034566 1:152911084-152911106 GCTGAAGCACCTAGAGGAGCAGG + Exonic
920242308 1:204562228-204562250 ACTGCAGCCCCACCAGGAGCTGG - Intergenic
920277676 1:204819539-204819561 GCTGCAGCACTCACAGCAGCTGG + Intergenic
920340375 1:205271854-205271876 GCTGCAGCAGCAACAGCAGCAGG + Exonic
921850423 1:219927966-219927988 CCTGCAGCAGCGGCAGCAGCTGG - Exonic
922777247 1:228220699-228220721 CATGGAGCACCGAGAGGAGAGGG - Intronic
923119674 1:230978635-230978657 GCTGCAGCACCGGCAGCAGCAGG - Exonic
923563669 1:235060742-235060764 CCTGCAGGACTGACATGCGCTGG - Intergenic
924375481 1:243403617-243403639 GCTGCTGCTCCGACAGGAGATGG - Intronic
924885317 1:248209680-248209702 CCTGCTACATCGACTGGAGCAGG - Intergenic
1063950465 10:11217644-11217666 CCTGCAGCAGCCACACCAGCTGG + Intronic
1066482450 10:35810100-35810122 TCTGCAGAGTCGACAGGAGCAGG + Intergenic
1066586760 10:36944311-36944333 TCTGCAGCACCCACGGGTGCAGG - Intergenic
1067031489 10:42880821-42880843 CCTGGAGCACAGACAGGGTCAGG + Intergenic
1067527768 10:47048634-47048656 CCTGCAACACCGAGAGGAAGAGG + Intergenic
1067753456 10:48986579-48986601 ACTCCAGCACTGACAGCAGCAGG + Intergenic
1067793370 10:49303936-49303958 CCTCCAGCAGAGACAGGAGAAGG + Intronic
1068919131 10:62464923-62464945 TCTGCAGCACCAGCAGGGGCCGG + Intronic
1069477464 10:68747466-68747488 CCTGCAGCAGTGACTGGGGCTGG - Exonic
1069570780 10:69493129-69493151 CCTTCATCACCCAGAGGAGCAGG + Intronic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1071524630 10:86351337-86351359 CTTGCAGCACACATAGGAGCTGG + Intronic
1071857872 10:89644687-89644709 GCTGCAGCTCCGGCAGGAGCGGG + Exonic
1072611029 10:97017777-97017799 CAGGCAGCACTGTCAGGAGCAGG + Intronic
1073108723 10:101048166-101048188 TCTTCATCACCGCCAGGAGCCGG - Intergenic
1073253123 10:102133802-102133824 CCTCCAGCCCCGGCAGGAGATGG - Intronic
1076362610 10:129899958-129899980 TCTGCAGCAACGACAAGAGCAGG - Intronic
1076672906 10:132132943-132132965 CCTACAGCAGAGTCAGGAGCTGG + Intronic
1077185869 11:1235078-1235100 CTTGCAGCACCTGCAGGAACCGG + Exonic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1078340496 11:10495193-10495215 CATGCAGCACTGCCTGGAGCAGG - Intronic
1081567343 11:44268213-44268235 CCTGGAGGAGGGACAGGAGCTGG + Intronic
1082087802 11:48064430-48064452 CCTGCAGCTCCGACTGCTGCTGG - Intronic
1082930432 11:58597709-58597731 ACTGCTGCACCTACAGTAGCAGG - Intronic
1084179959 11:67441238-67441260 CCTGTCCCCCCGACAGGAGCGGG - Exonic
1084564383 11:69920931-69920953 CCTGCAGCAGCCACAGGTGCAGG + Intergenic
1084592314 11:70097902-70097924 CTTCCAGCACGGATAGGAGCTGG - Intronic
1085037576 11:73309235-73309257 GCCGCAGCAGCAACAGGAGCGGG + Exonic
1087446593 11:98262498-98262520 CCTTCAGCCCTGACAGGAGAAGG + Intergenic
1089270015 11:117295638-117295660 CCTGCAGCAGCAGCAGCAGCAGG - Intronic
1090799444 11:130161162-130161184 CCTGCACCACAGACAGGACCTGG + Intronic
1091311635 11:134579244-134579266 CCTGCAGCACCGGGAACAGCAGG - Intergenic
1097348859 12:58525395-58525417 CCAGAAGCAGAGACAGGAGCTGG - Intergenic
1100951326 12:99853339-99853361 CCTGCTACACCCACAAGAGCAGG + Intronic
1101957959 12:109227412-109227434 CCTGCAGCACCGGCAGCTCCCGG + Exonic
1102780654 12:115561854-115561876 CCTGGAGCAGGGTCAGGAGCTGG - Intergenic
1103879799 12:124157372-124157394 CCAGCAGCACCGCCAGGAGGTGG + Intronic
1103949226 12:124542206-124542228 CCTGCAGCAGCCACAGGAACAGG + Intronic
1103977913 12:124715686-124715708 CATGTTGCACCCACAGGAGCTGG + Intergenic
1104051229 12:125195191-125195213 CCAGCACCACGGACAGGGGCTGG - Intronic
1104448857 12:128853590-128853612 GCCGCAGCACCGCCAGGAACAGG - Exonic
1104914638 12:132258272-132258294 AATGCAGCTCCCACAGGAGCAGG - Intronic
1104916841 12:132269838-132269860 CCTGCAGCACACACAGGCGAGGG + Intronic
1105578839 13:21675327-21675349 CCTGCCGCAGCGGCAGCAGCGGG - Intronic
1105956328 13:25287010-25287032 CCTCCTGTACCTACAGGAGCAGG - Intronic
1106436770 13:29730262-29730284 CCTGCAGGAACCACAGAAGCTGG - Intergenic
1109376595 13:61503171-61503193 CCTACAGGACCGAAAGAAGCAGG + Intergenic
1111285400 13:86084846-86084868 CCTGCAGATCTGACAGGAGGTGG + Intergenic
1114529139 14:23384603-23384625 CCTGCAGCACCGGCTGGACGAGG - Exonic
1114595629 14:23909372-23909394 CCAGCAGCACTGCCAGCAGCTGG + Intergenic
1114655009 14:24310742-24310764 CCAGCAGCGCCGCCAGCAGCAGG - Exonic
1115091562 14:29583072-29583094 CCTGCAGCTCCACAAGGAGCTGG + Intronic
1116864125 14:50017588-50017610 CCTTCAGCATCGACAAAAGCTGG + Intergenic
1117293814 14:54360712-54360734 CCTGCAGCAGGGACAGCACCAGG + Intergenic
1119182809 14:72615684-72615706 CCTGGGGCAGGGACAGGAGCAGG + Intergenic
1119261310 14:73239790-73239812 CCAGCAGCAGCGGCACGAGCAGG - Exonic
1120996035 14:90419472-90419494 CCTGCAGGCCCGCCTGGAGCAGG - Intergenic
1121044683 14:90779025-90779047 CCTCCAGCACAGTCATGAGCTGG - Intronic
1122840941 14:104462201-104462223 CCTCCAGCCCCCACAGGAGAGGG + Intergenic
1122884975 14:104706933-104706955 CCTGCAGCACCGACAGGAGCTGG - Exonic
1123932740 15:25179653-25179675 CCTGCAGCACCACCAGGTGAAGG - Intergenic
1123936911 15:25198488-25198510 CCTGCAGCATCACCAGGCGCTGG - Intergenic
1123939275 15:25208999-25209021 CCTGCAACACCATCAGGTGCTGG - Intergenic
1123940117 15:25212690-25212712 CCTGAAGCACCACCAGGAGCTGG - Intergenic
1123940553 15:25214552-25214574 CCTGCAGCACCACCAGGTGCCGG - Intergenic
1124582624 15:30973655-30973677 GCTGCAGCACAGACTGGAACGGG + Intronic
1125598088 15:40900198-40900220 CCTGGAGGCCCGACAGGAGGAGG + Exonic
1126410936 15:48372303-48372325 CCTGCAGGACATACAAGAGCAGG - Intergenic
1127264097 15:57347143-57347165 CCTGCAGCACCAACAGGGTAGGG + Intergenic
1128304015 15:66586404-66586426 CCTCCAGCACCGAGGGGAGACGG + Intronic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129263935 15:74383870-74383892 CCTGCACCACCTGGAGGAGCCGG + Intergenic
1129389042 15:75211381-75211403 CCTGCAGCAAGAACACGAGCCGG - Exonic
1130119872 15:81038583-81038605 ACAGCAGCACTGACAGAAGCAGG + Intronic
1130287223 15:82566067-82566089 GCTGTAAAACCGACAGGAGCTGG - Intronic
1131270868 15:90946962-90946984 CCTGCAACACCGGCTGGACCAGG - Intronic
1131466053 15:92655614-92655636 GCAGCAGCAGCGGCAGGAGCGGG + Exonic
1132542803 16:519185-519207 CGTGCTCCACCCACAGGAGCAGG + Intronic
1132761137 16:1509161-1509183 CCTGAAGCACCAGGAGGAGCAGG + Intronic
1133136122 16:3713327-3713349 CAGGCACCACCTACAGGAGCGGG + Intronic
1135303487 16:21350156-21350178 CCTGCAGCACAGGCAGCAGCAGG + Intergenic
1136300234 16:29329350-29329372 CCTGCAGCACAGGCAGCAGCAGG + Intergenic
1136394630 16:29986393-29986415 CCTGCAGCACCAGACGGAGCTGG + Exonic
1137673689 16:50293359-50293381 CCGGAAGCACTGACAGCAGCAGG - Exonic
1141237059 16:82228552-82228574 CCTGCACCTCCGACTGGAACCGG - Intergenic
1142027787 16:87823805-87823827 CCTGCAGCAGCCAGAGGAGGAGG - Intergenic
1142061964 16:88036114-88036136 CCTGCAGCACAGGCAGCAGCAGG + Intronic
1142186327 16:88696432-88696454 CCTCCAACACAGACAGCAGCTGG + Intergenic
1142197074 16:88743932-88743954 GCTGCAGCCCCGACACGAACAGG + Intronic
1143130315 17:4673330-4673352 CCAGCAGCAGCGCCAGCAGCAGG + Exonic
1143352239 17:6297482-6297504 CCTGCAGCACTTCCAGCAGCTGG - Intergenic
1143400372 17:6639151-6639173 CCTGCGGCACCCACAGAAGTAGG + Intronic
1143447496 17:7018062-7018084 CCAGCACCACCTCCAGGAGCGGG + Intergenic
1144726783 17:17506261-17506283 CCACCAGCACCGTCAGGAGCAGG + Exonic
1144872865 17:18381396-18381418 CCTGCAGCACCAGCAGGAGACGG + Exonic
1145094263 17:20010330-20010352 CCTGCAGCTCCTACAGTTGCTGG - Intronic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1149649984 17:58270811-58270833 CATGCAGCAGCGACAGGCCCTGG - Exonic
1151570883 17:74924716-74924738 CCAGCAGCACCGACAGCAGGCGG - Exonic
1151748383 17:76023603-76023625 CCTGCAGCACCAGCAGGAGACGG - Exonic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1152557780 17:81063057-81063079 CCTCCAGGGCCCACAGGAGCGGG + Intronic
1152606955 17:81296161-81296183 TCTGCAGCACCTGCAGGACCAGG + Intergenic
1152924168 17:83079914-83079936 CCAGCAGCCCGGCCAGGAGCAGG - Exonic
1153853895 18:9125785-9125807 CCAGCAGTACTGCCAGGAGCAGG - Intronic
1154092515 18:11378658-11378680 CCTGCAGGGACTACAGGAGCCGG + Intergenic
1154131102 18:11737913-11737935 CCCCCTGCACCCACAGGAGCTGG + Intronic
1156781659 18:40857747-40857769 CCTGCTGCTCTGACAGGAGGTGG - Intergenic
1160261216 18:77295936-77295958 CATGCAGAATAGACAGGAGCTGG + Intergenic
1160563502 18:79772944-79772966 CCTCCTGCACCCTCAGGAGCAGG - Intergenic
1160818333 19:1046540-1046562 CCTGCTGCAGCGGGAGGAGCAGG + Intronic
1160988738 19:1852035-1852057 CCTGCGGCACCGGAAGGGGCGGG + Intergenic
1161038818 19:2099333-2099355 CAAGCAGCACTGACAGCAGCTGG + Exonic
1161118757 19:2513465-2513487 TCTGCGGCACGGACGGGAGCAGG - Exonic
1161250173 19:3276063-3276085 CCTGCAGCATGGGGAGGAGCTGG + Intronic
1162027100 19:7900613-7900635 CCTGCAGAACCTACAGCACCTGG + Exonic
1162125634 19:8498342-8498364 CGGGCGGCACCGGCAGGAGCGGG - Intronic
1162328047 19:10010319-10010341 GCTGCAGCGCGGCCAGGAGCAGG + Exonic
1162718515 19:12648249-12648271 CCTCCTGCTCCGCCAGGAGCCGG + Exonic
1163171326 19:15533095-15533117 ACTGAAGCTCCAACAGGAGCTGG - Intronic
1163696737 19:18768123-18768145 CCCGCAGCACCCACAGGGGCTGG + Intronic
1164051308 19:21587231-21587253 CCTGCTGTCCGGACAGGAGCGGG + Intergenic
1166102407 19:40578469-40578491 CCTGCAGCTTCGAGAGGAGTTGG + Exonic
926489015 2:13500664-13500686 CCTCCAGCACTGACTGGTGCTGG + Intergenic
927706639 2:25300228-25300250 CCTGCAGGACGGAGAGGAGCAGG - Exonic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
928214954 2:29353590-29353612 CCTGGTGTACAGACAGGAGCAGG - Intronic
930037915 2:47099397-47099419 GCCTCAGCACCGGCAGGAGCAGG + Intronic
930463887 2:51719812-51719834 CCAGCAGCACTGACATCAGCTGG + Intergenic
932056420 2:68448225-68448247 CCTGGAGCACCGACAGCCCCTGG + Intergenic
932106267 2:68945432-68945454 CCTCCAGCACCGACATTATCTGG + Exonic
932412632 2:71556273-71556295 CCTGCAGCAGCGGCAGCTGCGGG + Intronic
932695246 2:73950840-73950862 CCTGCAGCACAGAGAGCAGTGGG + Intronic
934758903 2:96842679-96842701 CCTGCAGCACCCACAGGGTGAGG - Intronic
935137566 2:100321454-100321476 CCTGCAGCGCCAGCAGCAGCCGG - Exonic
936077767 2:109412565-109412587 CCTGCAGCACCAGCAGGGGCTGG - Intronic
937120748 2:119438630-119438652 CCTGCAGCAGTGACAAGACCGGG - Intergenic
938392511 2:130916548-130916570 ACTGCAGGGCCGGCAGGAGCGGG + Intronic
939011269 2:136848393-136848415 CCTGCAGCATCAACAGCACCTGG - Intronic
943525095 2:189006405-189006427 CCAGCTGGACCGACAGGACCAGG - Exonic
943528223 2:189045825-189045847 CCTGGAGCACCCACAGGGCCAGG + Exonic
943721424 2:191206939-191206961 GCTGCAGCACAGACAGGAGGTGG - Intergenic
945903814 2:215568523-215568545 CCTGCAGTACAGAGAAGAGCAGG - Intergenic
946339915 2:219060407-219060429 CCAGCAGCAGCAACAGGACCAGG + Exonic
946716505 2:222559184-222559206 CGTGCAACAGCGAGAGGAGCAGG - Exonic
947944476 2:234089873-234089895 CCTGGAGCCCCCACAGGAACCGG - Intergenic
1168826871 20:819862-819884 CCCGCAGCCCCGGCAGGAGAGGG - Intergenic
1171767452 20:29297892-29297914 CGGCCAGCCCCGACAGGAGCAGG + Intergenic
1171963746 20:31514503-31514525 CCTGCTGCAGCAACCGGAGCTGG + Exonic
1172763843 20:37340450-37340472 CCTGCCGCACAGAGAGGAGACGG - Intergenic
1174123653 20:48286953-48286975 CCTGCAGCATGGACAGGGGAAGG + Intergenic
1175117312 20:56691645-56691667 CCTTCACCACCGAGAGAAGCAGG + Intergenic
1175515513 20:59567445-59567467 CCTGCTGCACAGCCAGGAGAGGG - Intergenic
1176177787 20:63736851-63736873 CCAGCAGCAGAGACAGAAGCTGG - Intronic
1178486902 21:33025232-33025254 GCTGCAGCTCCGACGGCAGCCGG - Intergenic
1179578226 21:42321046-42321068 ACTTCAGCACCCCCAGGAGCCGG + Intergenic
1179890527 21:44333042-44333064 CCTGCCGCGCCTACAGAAGCTGG - Exonic
1180035574 21:45246432-45246454 CCACCAGCACCCACAGGAGCAGG + Intergenic
1180154786 21:45972616-45972638 CCGGCAGGACCGACAGCATCGGG + Intergenic
1180707704 22:17819216-17819238 CCTGCAGCAGGCACAGGTGCAGG - Intronic
1180719758 22:17898878-17898900 CAGGCAGCACTGACAGGATCAGG - Intronic
1180802234 22:18637287-18637309 CCAGCAGCACCTCCAGCAGCAGG + Intergenic
1180853473 22:19032839-19032861 CCAGCAGCACCTCCAGCAGCAGG + Intergenic
1181107999 22:20585969-20585991 CCTCCTGCACAGACAGCAGCGGG + Intronic
1181162423 22:20966424-20966446 CCTCGAGGACCGACAGGCGCAGG + Intronic
1181460461 22:23083153-23083175 CCTGCAGCTCGGAGAGGGGCAGG + Intronic
1182116249 22:27758087-27758109 CCTGAAGCACCAACCAGAGCAGG + Intronic
1182354012 22:29714037-29714059 CCTGTGGCAGCGAGAGGAGCAGG - Intergenic
1183617784 22:38955621-38955643 TCTGCAGCCCAGACATGAGCGGG - Intronic
1183921991 22:41177162-41177184 GCTGCAGCACCGACTACAGCAGG + Exonic
1184264883 22:43341709-43341731 TCTCCAGCCCAGACAGGAGCGGG - Intronic
1184786308 22:46673604-46673626 CCTGCAGCACCCAGATGTGCTGG - Intronic
1185294883 22:50048247-50048269 CCTGGAGGACAGACAGAAGCAGG - Intronic
953850753 3:46464085-46464107 CCTGCAGCACCGGGAGGGGAAGG - Intronic
953931048 3:47005826-47005848 CCAGCAGCACCGCCAGGCTCTGG + Exonic
954493588 3:50930929-50930951 CCTGCAGCAGTGGCAGGAGAGGG + Intronic
956518666 3:70079867-70079889 GCTGCAGCACTCACAGCAGCTGG - Intergenic
961440027 3:126947250-126947272 CCTGCAGCATCAACATGAGGTGG - Intronic
961647140 3:128398624-128398646 CCTGCAGGCCCGGCAGGGGCAGG - Intronic
962247293 3:133806153-133806175 CCTGAAGCAGCGGCAGCAGCTGG + Intronic
962835670 3:139186362-139186384 CCTGAGGCACAGACAGGAGGGGG - Intronic
968743101 4:2341118-2341140 CCTGCAGCATGGGCAGCAGCAGG - Intronic
969042992 4:4315528-4315550 TCTGCAGCAGTGTCAGGAGCAGG + Intronic
969160067 4:5249151-5249173 CCTGTAGCAGCAACAGCAGCAGG - Intronic
969342289 4:6549710-6549732 CCTGCAGCACGGGCAGTAGCTGG + Intronic
969429285 4:7144897-7144919 TCAGCAGCAAGGACAGGAGCAGG - Intergenic
969630610 4:8333734-8333756 CCTGCAGCAGCGGCAGGCTCTGG + Intergenic
977892431 4:102327480-102327502 CTTGCAGGACAGACAGGAGTTGG - Intronic
985570885 5:644095-644117 CCTGCAGCACCCTCAGGGGAGGG - Intronic
985647026 5:1089795-1089817 TCAGCAGCACAGCCAGGAGCAGG + Intronic
985824490 5:2182155-2182177 ACTGCAGCACCGTCAGCAGGTGG - Intergenic
986311176 5:6552098-6552120 CCTTCAGCACCGACAGCTGAAGG + Intergenic
986428081 5:7654498-7654520 CATGAAGCTCTGACAGGAGCAGG + Intronic
988065590 5:26226536-26226558 GCTGTAGAACCGAGAGGAGCTGG - Intergenic
993644116 5:90441889-90441911 CCTGCAGCACTGCCAGATGCAGG + Intergenic
995492517 5:112707788-112707810 CCTGGAGCACCGGCGGCAGCAGG + Intronic
995574372 5:113513929-113513951 CCTCCGCCACCGCCAGGAGCCGG - Exonic
995625167 5:114068609-114068631 TCTGCAGCAGAGATAGGAGCAGG - Intergenic
996343904 5:122469432-122469454 CCAGCAGTACCGCCAGCAGCTGG - Intergenic
996898685 5:128518508-128518530 CCTGCTGCAACGACAGGTCCTGG + Intronic
999069306 5:148726636-148726658 CCAGCAGCAACTCCAGGAGCAGG - Intergenic
999128832 5:149267036-149267058 CCTGAAGCACCTACAGGGCCGGG - Intergenic
1000367351 5:160504238-160504260 CCTGGATCAGGGACAGGAGCAGG - Intergenic
1002520882 5:179792833-179792855 CCAGAAGCACGGGCAGGAGCTGG - Intronic
1002546957 5:179955156-179955178 GCTGCAGCACCCCCAGCAGCAGG - Exonic
1002789809 6:428673-428695 CCTGCAGGCCTGACAGGAGAGGG + Intergenic
1005854518 6:29850592-29850614 ACTGCAGCAGCGACAGGAGGAGG - Intergenic
1006312174 6:33268591-33268613 CTTGGAGCAGCTACAGGAGCTGG - Exonic
1006848270 6:37078260-37078282 GCTGCTGCACCTAGAGGAGCTGG - Intergenic
1007409386 6:41653217-41653239 CCTGCGGCAGCGGCAGCAGCAGG - Intronic
1011301145 6:85875496-85875518 CCAGCAGTACAGAGAGGAGCTGG - Intergenic
1012432920 6:99185198-99185220 CCGGCCGCACCTACATGAGCTGG - Intergenic
1016497048 6:144675341-144675363 CCTGCAGCCTCCACTGGAGCAGG - Intronic
1019319375 7:408706-408728 CCTGCAGCACCGGCAGCTGTGGG + Intergenic
1019780834 7:2938738-2938760 CCTGGAGGACAGGCAGGAGCTGG - Exonic
1020138598 7:5599868-5599890 CAGGCAGCACCCACAGGAGAGGG - Intronic
1022528256 7:31052142-31052164 CCCGCAGCACAGACTGGAGCAGG - Intergenic
1023819192 7:43970913-43970935 CCAGCGTCACAGACAGGAGCAGG + Intergenic
1023829246 7:44029414-44029436 CCTGCAGCACCCGGAGCAGCCGG + Intergenic
1026232046 7:68493396-68493418 CCTGCAGCACCAGCAGCAACTGG - Intergenic
1026441300 7:70446729-70446751 CCTGAAGCACACACTGGAGCTGG - Intronic
1027361748 7:77416439-77416461 GCTGCAGAACCGAAAGCAGCAGG - Intergenic
1028753577 7:94409774-94409796 CCGGCAGCACCAACAGGGCCAGG - Exonic
1029379064 7:100200783-100200805 CCTGCAGCAACTCCAGGAGGTGG + Exonic
1029504383 7:100953547-100953569 ACTGCAGCAACTACAGGAACAGG + Exonic
1029739552 7:102483672-102483694 CCTGCAGCACCCGGAGCAGCCGG + Exonic
1029744242 7:102507876-102507898 CCAGCGTCACAGACAGGAGCAGG + Intronic
1029757553 7:102582851-102582873 CCTGCAGCACCCGGAGCAGCCGG + Exonic
1029762233 7:102607038-102607060 CCAGCGTCACAGACAGGAGCAGG + Intronic
1029775491 7:102681912-102681934 CCTGCAGCACCCGGAGCAGCCGG + Intergenic
1031185697 7:118477084-118477106 CCTGAAGCAACAACAGGAACAGG + Intergenic
1032682934 7:134203947-134203969 GGTACAGCCCCGACAGGAGCAGG - Intronic
1032801116 7:135317893-135317915 CCTGCAGGACAGGCTGGAGCGGG - Intergenic
1034467625 7:151239132-151239154 CCAGCAGCGCAGGCAGGAGCTGG - Exonic
1034550952 7:151820395-151820417 CCTGCAGAAGCCACAGGGGCCGG - Intronic
1037717067 8:21409597-21409619 ACTGCAGCACACACAGGGGCAGG + Intergenic
1037811419 8:22089262-22089284 CCTGCAGCAGCGCCCCGAGCCGG - Exonic
1037890049 8:22619277-22619299 CCTGCAGCAGCCGCTGGAGCTGG - Exonic
1041488609 8:58407314-58407336 ACGTCAGAACCGACAGGAGCTGG - Intergenic
1043539874 8:81249244-81249266 ACTGCAACAGCAACAGGAGCTGG - Intergenic
1045365748 8:101474351-101474373 CCTGCAGCAGGGAACGGAGCGGG + Intergenic
1045672607 8:104573114-104573136 CCAGCAGCACCGATAGTAGTAGG + Intronic
1047933014 8:129749451-129749473 CCTGCTTCAGCAACAGGAGCTGG - Exonic
1049267377 8:141675854-141675876 CCTGCCCCCCCGACTGGAGCTGG - Intergenic
1049551999 8:143264311-143264333 CCAGCAGCACTGGCTGGAGCAGG + Intronic
1050046564 9:1552820-1552842 GCTGGAGCAGCGTCAGGAGCAGG + Intergenic
1052862847 9:33447452-33447474 CCGGCTGCTCCGACAGGCGCTGG - Exonic
1053346389 9:37381576-37381598 TCTGCAGCCCGGACAGGAGCTGG - Intergenic
1053896290 9:42743745-42743767 CCTGGAGCTCCGAGAGGAGCCGG - Intergenic
1056246988 9:84705505-84705527 CCAGCAGCACCGCAAAGAGCGGG - Intronic
1060404505 9:123366555-123366577 CCCGCAGCAACCCCAGGAGCAGG - Intronic
1062168949 9:135123743-135123765 CCTGCAGCTCTGACAGGGCCAGG - Intergenic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1062436123 9:136547310-136547332 CCAGCAGCAGCTACAGGGGCGGG - Intergenic
1062462432 9:136667499-136667521 CCTGCTGCACAGCCAGGAGGGGG + Intronic
1062720885 9:138043390-138043412 CCCGCAGCACAGGGAGGAGCAGG - Intronic
1187182539 X:16956606-16956628 CCTGCAGGACAGACTGGAGGAGG - Intronic
1187443775 X:19343599-19343621 GCTGCAGCACCGGCAGGAGTAGG + Intergenic
1192317261 X:70062692-70062714 TCAGAAGCACCGGCAGGAGCTGG + Exonic
1194989981 X:100536954-100536976 CTTGGAGCACTGACAGGACCTGG - Intergenic
1198014113 X:132591218-132591240 CCAGCAGCACCGACATCACCTGG - Intergenic
1198286192 X:135194417-135194439 GCAGCAGGACCCACAGGAGCAGG - Intergenic
1198286217 X:135194523-135194545 GCAGCAGGACCCACAGGAGCAGG - Intergenic
1198286225 X:135194553-135194575 GCAGCAGGACCCACAGGAGCAGG - Intergenic
1200018591 X:153183133-153183155 CCTGGAGTACCGGCAGGTGCCGG + Exonic
1200110074 X:153736542-153736564 CCTGCAGCAGCAGCAGGGGCGGG - Intronic
1201073189 Y:10168769-10168791 GCTGCAGCCCCACCAGGAGCCGG + Intergenic