ID: 1122885881

View in Genome Browser
Species Human (GRCh38)
Location 14:104710068-104710090
Sequence TAGCTGGGGATGGCACAGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122885881_1122885888 13 Left 1122885881 14:104710068-104710090 CCTGTCTGTGCCATCCCCAGCTA 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1122885888 14:104710104-104710126 GAGTGCATGCTGCTGTGTGAGGG 0: 1
1: 0
2: 2
3: 22
4: 209
1122885881_1122885887 12 Left 1122885881 14:104710068-104710090 CCTGTCTGTGCCATCCCCAGCTA 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1122885887 14:104710103-104710125 CGAGTGCATGCTGCTGTGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 151
1122885881_1122885890 30 Left 1122885881 14:104710068-104710090 CCTGTCTGTGCCATCCCCAGCTA 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1122885890 14:104710121-104710143 TGAGGGCGCGGCCGCCGTGCTGG 0: 1
1: 0
2: 2
3: 10
4: 158
1122885881_1122885889 18 Left 1122885881 14:104710068-104710090 CCTGTCTGTGCCATCCCCAGCTA 0: 1
1: 0
2: 0
3: 10
4: 196
Right 1122885889 14:104710109-104710131 CATGCTGCTGTGTGAGGGCGCGG 0: 1
1: 0
2: 2
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122885881 Original CRISPR TAGCTGGGGATGGCACAGAC AGG (reversed) Exonic
900440249 1:2651358-2651380 TAGATGAGTATGGGACAGACTGG + Intronic
901060142 1:6468096-6468118 TACCTGGGGCTGGAACAGCCAGG + Exonic
901067868 1:6502931-6502953 GAGCTGGGGCAGGCACACACGGG + Intronic
901137183 1:7005564-7005586 TAGATGGTGAAGGCAAAGACAGG - Intronic
903327412 1:22577368-22577390 CAGCTGGGGATGGCAGAGCTGGG + Intronic
903389486 1:22953899-22953921 CCGCTGGGGATGGCAGACACGGG - Exonic
903665226 1:25002975-25002997 TAGCTGGGGGTGGCTCAGAAGGG - Intergenic
903680117 1:25090881-25090903 GAGCTGGGGAAGGCAGAGGCAGG + Intergenic
904450886 1:30610740-30610762 CAGCTGGCAATGGCAGAGACGGG - Intergenic
904635361 1:31876744-31876766 TAGCTGGGACTGGCTGAGACTGG + Intergenic
905433318 1:37940341-37940363 TAGCTGTGGGTGGCAGAGAGAGG + Intronic
905653904 1:39673620-39673642 GAGCTGGGGCTGGGACAGCCAGG - Intergenic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
908559650 1:65292871-65292893 CAGCTGAGGTTGGCCCAGACTGG - Intronic
909348292 1:74618049-74618071 TAGCTGGGCATGGCTGAGATAGG + Intronic
915334688 1:155134256-155134278 AAGGTGGGGATGGCACTGTCGGG - Exonic
919474764 1:198019856-198019878 TGGCAGTGGATGGCATAGACTGG - Intergenic
920068279 1:203284587-203284609 GAGCTGGGGCTGGGACTGACGGG + Intergenic
922998518 1:229985868-229985890 GAGCTGGGGAAGGCAGAGACGGG + Intergenic
1062920397 10:1274777-1274799 CAGCAGGGGGTGGCAGAGACGGG + Intronic
1067745117 10:48929741-48929763 GAGCTGGGCTTGGGACAGACAGG - Intronic
1069346560 10:67476986-67477008 TCGCTGGGCATGGGACAGAGAGG - Intronic
1070446585 10:76510522-76510544 TAGCTGGGAAGAGCACAGACAGG + Intronic
1072425521 10:95327050-95327072 TACCTGGGGAGGGCTCAGAGAGG - Intronic
1073200872 10:101734251-101734273 TACCTAGGGATGGAACAGAGGGG + Intergenic
1074719912 10:116255663-116255685 TGGAAGGGGATGGCAGAGACCGG - Intronic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1076573990 10:131451864-131451886 GAGCTGAGGAAGGCACAGATGGG + Intergenic
1076915572 10:133421746-133421768 CAGCTGGGGAAGGCAGAGGCTGG + Exonic
1079112567 11:17612978-17613000 AAGCTGGGAATGGGACAGGCTGG - Intronic
1081602906 11:44507611-44507633 CAGCTGGGGATGTGACAGTCTGG - Intergenic
1083162796 11:60865629-60865651 TAGAGGGGAATGGCACACACTGG - Intergenic
1083225455 11:61281724-61281746 TAGCTGGGGCAGGCACTGAGGGG + Intronic
1083436711 11:62648030-62648052 CAGCTGGGGATGTCTGAGACAGG + Exonic
1083863810 11:65442482-65442504 AAGCTGGGGCTGGCAGGGACAGG + Intergenic
1083994732 11:66266339-66266361 GGGCTGGGGAGGGAACAGACTGG - Intronic
1084089133 11:66868983-66869005 GAGCAGGGGAGGGCACAGGCAGG + Intronic
1084122660 11:67078338-67078360 GAGCTGGGGAAGGCCCAGCCTGG + Intergenic
1084225133 11:67711022-67711044 TGGCTGGGGCTGGCAAAGGCAGG + Intergenic
1084262952 11:67990864-67990886 TGGCTGGGGCTGGCAAAGGCAGG + Intergenic
1084494158 11:69494485-69494507 AAGCAGGAGATGGCACAGATGGG + Intergenic
1084810441 11:71608252-71608274 TGGCTGGGGCTGGCAAAGGCAGG - Intergenic
1092055586 12:5505777-5505799 CACCAGGGGCTGGCACAGACTGG - Intronic
1103402178 12:120650540-120650562 AGGCTGGGGTTGGCAGAGACTGG + Intronic
1103596705 12:122028659-122028681 TAGCTTGGGGTCTCACAGACAGG - Intronic
1103998347 12:124844338-124844360 GAGCTGGGGGTGGCACAGGGAGG - Intronic
1106112125 13:26786294-26786316 TTGCTGGGGGTGCCACAGCCTGG - Intergenic
1106890696 13:34242402-34242424 TTGCTGGGGAAGGATCAGACTGG - Intergenic
1107753210 13:43591573-43591595 TAGCTGGGCAGTGCACACACAGG + Intronic
1108706101 13:52989215-52989237 TAGGTGGGGATGGGAGACACAGG - Intergenic
1112028766 13:95438274-95438296 TAGCTGGACATGGTAAAGACAGG + Intronic
1114832769 14:26164627-26164649 TGCCTGGGGATGGCGCAGAGAGG + Intergenic
1119543275 14:75454489-75454511 GAGCTGAGCATGGCACAGAATGG - Intronic
1122885881 14:104710068-104710090 TAGCTGGGGATGGCACAGACAGG - Exonic
1124256486 15:28146860-28146882 TAGCAGAGGATGGCACTGAGAGG + Intronic
1124567744 15:30832233-30832255 TAGCAGAGGATGGCACTGAGAGG - Intergenic
1127556818 15:60095563-60095585 TATCTGGGGATGGGGCAGAGTGG + Intergenic
1128517035 15:68348852-68348874 GGGCTGGAGATGTCACAGACGGG - Exonic
1128811944 15:70579421-70579443 TGGCTGGGCATGGCTCAGAGCGG + Intergenic
1129465515 15:75722285-75722307 TTGATGGGGAGGGCACAGTCTGG + Intergenic
1130796379 15:87214217-87214239 TAGCTGGGTATGACACATGCTGG - Intergenic
1131253398 15:90845617-90845639 GAGCTAGGGAGGGCACAGCCAGG - Intergenic
1132804521 16:1769394-1769416 CAGCTGGGGTGGGGACAGACAGG - Exonic
1133129041 16:3664855-3664877 CAGCTGGCTATGGCAGAGACTGG + Exonic
1133157710 16:3887423-3887445 TAGCTAGGAATGGAAGAGACAGG - Intergenic
1134492458 16:14705198-14705220 TAACTGGTGGTGGTACAGACGGG - Intergenic
1134497839 16:14744320-14744342 TAACTGGTGGTGGTACAGACGGG - Intronic
1134890712 16:17839396-17839418 AAGCCGGGGATGGCACAGTCAGG + Intergenic
1136139155 16:28277679-28277701 ACTCTGGGGCTGGCACAGACCGG + Intergenic
1136550096 16:30978485-30978507 TGGCTGGGGAGGGAACACACTGG - Intronic
1138659808 16:58510327-58510349 AAGCTGGGAAGGGCACAGAGCGG + Intronic
1138719418 16:59061657-59061679 GGGCTGGGGATAGCACAGAGAGG - Intergenic
1139947589 16:70651713-70651735 TAGCTGGGGGTGGCTCAGGGAGG + Intronic
1141148877 16:81550819-81550841 GAACTGGGGAGGGCACAGAATGG - Intronic
1141875987 16:86824903-86824925 CAGCTGGGAATGGGACAGGCTGG - Intergenic
1143864206 17:9911983-9912005 TAGCTGGTGATCACACAGCCTGG - Intronic
1148095570 17:45050871-45050893 GAGCTGGGGAAGGAAGAGACGGG + Intronic
1148147347 17:45374083-45374105 TGGATGGGGATGGAACAGAGAGG - Intergenic
1149640370 17:58198947-58198969 GGGCTGGGGATGGGAGAGACGGG - Intronic
1150004497 17:61461751-61461773 AAGGTGGGGATGGCTCTGACTGG - Intronic
1150710265 17:67525234-67525256 CAGCTGAGGGTGGCCCAGACTGG + Intronic
1151323646 17:73366050-73366072 CAGCTGGGGATGCCGCAGATTGG - Intronic
1151677638 17:75607010-75607032 GAGCTGGGGATGCCAGAGACGGG + Intergenic
1152281081 17:79385165-79385187 TAACTGGGAAGGGCAGAGACGGG + Intronic
1152836200 17:82533827-82533849 TAGCTGGGCCTGGCACAGCTAGG + Intronic
1153527820 18:6014549-6014571 TAGCAGGGGATGGCAAAGTGAGG + Intronic
1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG + Intronic
1158510524 18:58086393-58086415 TGGCAGGGGATGGGAGAGACTGG + Intronic
1159440946 18:68479244-68479266 TAGCTGGGGCTGTTACTGACAGG - Intergenic
1159871943 18:73768301-73768323 TAGCTGGGGCTGGGACACAGGGG - Intergenic
1161245772 19:3250981-3251003 TAGGTGAGGAAGGCACAGCCTGG - Exonic
1161509565 19:4663007-4663029 TGGGAGGGGAAGGCACAGACTGG - Intronic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
1164438889 19:28256534-28256556 AAGCTGGGGTTGGCAGGGACAGG + Intergenic
1166778446 19:45326582-45326604 TAGGTGGGAATGGCAAAGACTGG - Intergenic
1167596325 19:50430183-50430205 TAGCCAGGGATGGCAGCGACTGG - Exonic
925941128 2:8820153-8820175 AGGCCGGGGGTGGCACAGACTGG - Intronic
925954965 2:8954632-8954654 TGCCTGGGCATGGAACAGACAGG + Intronic
927243406 2:20937868-20937890 TTAGAGGGGATGGCACAGACTGG + Intergenic
927918536 2:26952585-26952607 TAGCCGGGGATGCCACAGGGTGG + Intergenic
928231272 2:29500730-29500752 CAGCTGGGGATGGATGAGACAGG - Intronic
928605821 2:32944672-32944694 TACCTGTGGAGGGCACAGCCTGG - Intergenic
932418781 2:71589179-71589201 TAGCAGGGGGTGGCAGAGATGGG + Intronic
934773253 2:96921384-96921406 TGGGTGGGGATGGCACTGCCTGG - Intronic
939220200 2:139291912-139291934 TAGCTGGGAAGGGCGCAGAGTGG + Intergenic
940112925 2:150174198-150174220 TAGCTAGAAATAGCACAGACAGG + Intergenic
942515655 2:176750173-176750195 TAGCTGTGTATGGGACAGAAAGG - Intergenic
944447934 2:199810496-199810518 TAGCTGGGGATGGAAGAAAGAGG - Intronic
946469252 2:219941265-219941287 TAAATGGGCAAGGCACAGACTGG - Intergenic
947976797 2:234373623-234373645 GAGCTGGGGAAGGAACAGAATGG + Intergenic
1168937202 20:1675538-1675560 TAGCTGAGGGTTGCAGAGACAGG + Intergenic
1171462635 20:25307494-25307516 CAGCTGGGGAGGGCACAGGTTGG + Intronic
1173594596 20:44250516-44250538 TAGCTGGGAATGGCAGAGTTGGG - Intronic
1175353746 20:58345788-58345810 TGGCTGTGGATGGCACATTCTGG - Intronic
1176044846 20:63087219-63087241 GAGCTCTGGATGCCACAGACAGG - Intergenic
1176428346 21:6562132-6562154 CTGCTGGGGTTGGCAGAGACAGG - Intergenic
1178066123 21:28906393-28906415 TGGCTGGTGATGGGACAGACAGG + Intergenic
1179040606 21:37799095-37799117 TAGAGGGGAATGGCACACACTGG - Intronic
1179703836 21:43170448-43170470 CTGCTGGGGTTGGCAGAGACAGG - Intronic
1180802126 22:18636848-18636870 TTGCTGGGGATGGCACCAGCAGG - Intergenic
1180853364 22:19032400-19032422 TTGCTGGGGATGGCACCAGCAGG - Intergenic
1181219596 22:21358411-21358433 TTGCTGGGGATGGCACCAGCAGG + Intergenic
1181472323 22:23148305-23148327 TAACTAGGGATGACAGAGACTGG + Intronic
1181901782 22:26161956-26161978 TAGGTGGGGATGGCAGTGATGGG + Intergenic
1182372460 22:29821054-29821076 GAGCTGGGCCTGGCACAGAGGGG - Intronic
1183106746 22:35620446-35620468 AGGCTGGGCCTGGCACAGACTGG - Intronic
1184617654 22:45648829-45648851 TAGCATGGGATGGCGGAGACAGG - Intergenic
949368422 3:3308125-3308147 TAGCTGGGGAGGGCATATAATGG - Intergenic
952667360 3:35922744-35922766 TGCCTGGGGATGGCACAGAGAGG + Intergenic
956594095 3:70947777-70947799 AAGCTGGGGCTGGGAGAGACAGG - Intergenic
959336697 3:105076249-105076271 TAGCTGGGCATGGCTGAGATAGG - Intergenic
961128193 3:124440977-124440999 TAGCTGTGGGTGGCAGAGAGAGG - Intronic
961381378 3:126498372-126498394 TAGCTAGAGATGGTACAGCCAGG - Intronic
968431324 4:560855-560877 TGGGTGGGGATGGGCCAGACAGG + Intergenic
968808926 4:2791549-2791571 AAGCAGGGGATGGCAGAGGCAGG - Intergenic
969021461 4:4142780-4142802 TGGCTGGGGCTGGCAAAGGCAGG + Intergenic
969454501 4:7293643-7293665 TAGGCAGGGATGGCATAGACAGG + Intronic
969732403 4:8964636-8964658 TGGCTGGGGCTGGCAAAGGCAGG - Intergenic
969791985 4:9498719-9498741 TGGCTGGGGCTGGCAAAGGCAGG - Intergenic
970872210 4:20829003-20829025 TTGCTGGTGATGGCATAGGCAGG + Intronic
975938888 4:79616265-79616287 AAGCTTGGGATGGAAAAGACAGG + Intergenic
977284816 4:95089651-95089673 AATCTGGGCATGGCACACACAGG - Intronic
977693801 4:99946312-99946334 GGGCTGGGGCTGGCTCAGACAGG + Intronic
979104242 4:116664339-116664361 TAGCTGCGCGTGGGACAGACTGG + Intergenic
981264441 4:142765295-142765317 TAGGTGGGGGTGGCACTGAAGGG + Intronic
985541788 5:490810-490832 AAGCTGCCGAGGGCACAGACAGG - Intronic
987056403 5:14197306-14197328 GAGCTGGGGATAAGACAGACAGG - Intronic
987246461 5:16054103-16054125 AAGATGGGGATGGCACAGTGGGG + Intergenic
990823934 5:59875927-59875949 TAGAGGGGAATGGCACACACTGG + Intronic
991551587 5:67842868-67842890 TATCTGGGGATTTCACAGCCTGG + Intergenic
992156346 5:73958682-73958704 TGACTGGGGATGGAACAGATGGG + Intergenic
992570410 5:78049666-78049688 TAGGTGGTGGTGGCTCAGACCGG - Intronic
992847044 5:80760961-80760983 TAGCTGGGTTTGACAAAGACAGG - Intronic
997577249 5:134990086-134990108 TTGCTTGGGATGGCATAAACTGG - Intronic
997701883 5:135908008-135908030 TAGTCTGGGATGGCACAGTCAGG - Intergenic
1001281029 5:170386592-170386614 TAGCTGGGCCGGGCACAGGCAGG + Intronic
1003557197 6:7150728-7150750 AGGGTGGGGATGGCACAGAGGGG + Intronic
1003992450 6:11499454-11499476 TAGCTGGGTCTGGCACAGAGTGG - Intergenic
1004426321 6:15509605-15509627 CAGCTGGGGAGGGGACAGCCAGG + Intronic
1007065880 6:38990110-38990132 TATCTAGGGATGGCAGTGACTGG - Exonic
1007297723 6:40839357-40839379 AAGATGGGGCTGACACAGACAGG - Intergenic
1007426402 6:41748874-41748896 CAGCTGGGCCTGGCACAGAGAGG + Intronic
1008067124 6:47061702-47061724 TGGCTGGAGATAGCACAGAAAGG - Intergenic
1011434537 6:87322708-87322730 CAGCTGGGAAGGGCAGAGACGGG - Intronic
1011535348 6:88370522-88370544 CAGTAGGGGATGGCACAGCCTGG - Intergenic
1013584345 6:111565307-111565329 AAGATGGGGAGGGCACAGTCAGG - Intronic
1018283615 6:162214402-162214424 TAGTTGGGGATGGCAGCCACTGG + Intronic
1018724926 6:166604525-166604547 CAGCTGGGGATGGCCCCGCCCGG - Intronic
1019177185 6:170165909-170165931 AAGCTGGGGATGGCCCAGGTGGG + Intergenic
1019434113 7:1012938-1012960 TATCTTGGGATGACACAGGCGGG + Intronic
1024338267 7:48231460-48231482 TAGCAGGGGGTGGCATAGAAAGG + Intronic
1025888427 7:65621496-65621518 TAGCTAGGGATGTAACACACAGG + Intergenic
1026233902 7:68509536-68509558 TGGCTGGGGCTGGAACAGTCTGG - Intergenic
1029599130 7:101553591-101553613 TGGGTGGGGATGCCACAGAGGGG + Intronic
1029913127 7:104176327-104176349 TATCTGGGAAAGGCATAGACAGG + Intronic
1031854013 7:126900466-126900488 TAGCTAGGGATGTAACACACAGG - Intronic
1032444545 7:131970761-131970783 TGGCTGGGGGTGACACTGACAGG + Intergenic
1032702709 7:134396625-134396647 TGGCATGGGATGGCACAGAATGG - Intergenic
1034032813 7:147786523-147786545 CTGCTGGGGATGGCAGAGAGAGG + Intronic
1034338276 7:150337276-150337298 TAGGAGGGGTTGGCACAGAGCGG - Exonic
1034472591 7:151263438-151263460 AACCTGGGGAGGGCAAAGACAGG - Intronic
1034557158 7:151857584-151857606 TGGCAGGGGGTGGCACAGCCGGG - Intronic
1034745931 7:153524062-153524084 AAGCTAGGGAGGGCAGAGACTGG - Intergenic
1034879526 7:154752749-154752771 AGGATGTGGATGGCACAGACTGG + Intronic
1037654479 8:20871491-20871513 TAGCAGCGGCTGGCACAGAATGG + Intergenic
1039567726 8:38563553-38563575 AAGGTGGGGATGGGACAGAGGGG - Intergenic
1048504547 8:135009025-135009047 CAGCTGGTGATGACAGAGACAGG - Intergenic
1049331630 8:142057101-142057123 TAGCTGGGGAGAAGACAGACAGG - Intergenic
1049336947 8:142091753-142091775 TAGCAGGGGAGGGAACAGAGAGG + Intergenic
1052793589 9:32901919-32901941 TAGATGGGGCTGATACAGACAGG + Intergenic
1053509310 9:38673769-38673791 TTGCCGGGGATGGCACAGCTTGG - Intergenic
1056449677 9:86704804-86704826 GAGCTGGGGATGACACATATAGG - Intergenic
1056773287 9:89495224-89495246 TAGCTGGGGGTGTCACAGCAGGG - Intronic
1056932867 9:90893114-90893136 TAGTTGGGGCTGGGGCAGACAGG + Intronic
1057307196 9:93919329-93919351 GAGCTGGGGAGGGGACAGAAGGG - Intergenic
1058739916 9:107932650-107932672 GAGATGGAGATGGCTCAGACAGG - Intergenic
1187932243 X:24304054-24304076 CAGCTGGGGCTGGAACAGAGTGG - Intergenic
1188933238 X:36141429-36141451 CAGCTGGGGCTGGGACAAACAGG - Intronic
1190220987 X:48512196-48512218 TAGGTGGGCATGGGACAGATAGG - Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195966696 X:110435440-110435462 CAGCTGTGGTTTGCACAGACAGG - Intronic
1197704298 X:129622894-129622916 CAGCTGGGGATGACACTGACAGG - Intergenic
1198407324 X:136326443-136326465 TAGCTGGGGTTTGAACAGATTGG + Intronic
1198871622 X:141181512-141181534 AAGCTGGAGAGGGCAAAGACAGG - Intergenic
1200053332 X:153446006-153446028 TACCTGGGGCGGGCACTGACCGG + Exonic
1200155622 X:153973350-153973372 GAGCAGGTGGTGGCACAGACAGG - Intronic
1202099058 Y:21286637-21286659 TTGATGGGGATGGCATTGACGGG - Intergenic