ID: 1122888078

View in Genome Browser
Species Human (GRCh38)
Location 14:104719411-104719433
Sequence CACGCTGGGCAGCTGGCACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 203}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888078_1122888089 1 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888089 14:104719435-104719457 GCAGGCCCTGGGGACAATACAGG 0: 1
1: 0
2: 0
3: 17
4: 179
1122888078_1122888085 -10 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888085 14:104719424-104719446 GCCCAGCGTGGGCAGGCCCTGGG 0: 1
1: 1
2: 4
3: 37
4: 326
1122888078_1122888093 13 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888093 14:104719447-104719469 GACAATACAGGTCCACCTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 89
1122888078_1122888094 14 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888094 14:104719448-104719470 ACAATACAGGTCCACCTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1122888078_1122888092 12 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888092 14:104719446-104719468 GGACAATACAGGTCCACCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 81
1122888078_1122888096 22 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888096 14:104719456-104719478 GGTCCACCTGAGGGGCTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 213
1122888078_1122888087 -9 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888087 14:104719425-104719447 CCCAGCGTGGGCAGGCCCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 362
1122888078_1122888095 21 Left 1122888078 14:104719411-104719433 CCCAGTGCCAGCTGCCCAGCGTG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 1122888095 14:104719455-104719477 AGGTCCACCTGAGGGGCTGCAGG 0: 1
1: 0
2: 3
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888078 Original CRISPR CACGCTGGGCAGCTGGCACT GGG (reversed) Exonic
900620307 1:3584015-3584037 GAAGCTGGGCAGCTGGCAAATGG - Intronic
902086862 1:13869370-13869392 CACACTGAGCAGATGGCCCTTGG - Intergenic
902548658 1:17206296-17206318 CCAGGTGGGCAGCTGGCCCTGGG - Intronic
903271345 1:22190334-22190356 CAGCCTTGGCAGCTGGCCCTGGG + Intergenic
903466013 1:23553326-23553348 GTCGCTGGCCAGCTGGCAGTTGG - Intergenic
903775573 1:25791405-25791427 CACACAGGGCAGAGGGCACTCGG - Intergenic
904180689 1:28664624-28664646 CACGCTGAGGAGCTGGGACCTGG + Intergenic
905348201 1:37326190-37326212 GACACTGGTCAGCAGGCACTGGG - Intergenic
905395193 1:37662298-37662320 CCCACTGGGCACCTGGGACTTGG - Intergenic
905966767 1:42104827-42104849 CAGGCTGGCCAGCTGCCAGTGGG - Intergenic
906853855 1:49282985-49283007 CCAGCTGGGAAGCTGGAACTGGG + Intronic
907239942 1:53075780-53075802 CCCGGTGGGCAGCAGGCAGTGGG + Intronic
911244428 1:95501112-95501134 CACGCTGAGCAGCGGGGACAGGG - Intergenic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
912910946 1:113759022-113759044 CCCGCGGGGCAACGGGCACTAGG - Exonic
912950394 1:114116705-114116727 CTTGCTGGGAAGCTGGGACTGGG - Intronic
913503917 1:119498132-119498154 CAAGCTGGGAAGCTCGAACTGGG + Intergenic
914247209 1:145895335-145895357 CACCTTGGGCAGCTGGCAAAGGG - Exonic
915303574 1:154965423-154965445 CCCGCTGGGCAGCTGTCTATGGG - Intronic
916624608 1:166541575-166541597 CACGTTGGGCACCTGTCATTAGG - Intergenic
919905595 1:202076161-202076183 CAGGCTGGAGACCTGGCACTGGG + Intergenic
920678736 1:208056957-208056979 CACCCTGGCCTGCAGGCACTGGG - Intronic
922056325 1:222045623-222045645 CACGTTGGGGAGCTGGCATTGGG + Intergenic
1064140756 10:12788277-12788299 AACTCTGGGCACCTGGCACGGGG + Intronic
1065044321 10:21732388-21732410 CATGCTGAGCAGCTGGGATTAGG + Intronic
1067474445 10:46556668-46556690 CCAGCGGGGCAGCTGGCACCGGG + Intergenic
1068116235 10:52740403-52740425 CTCGCTTGGCATCTGGCATTTGG - Intergenic
1068609514 10:59043514-59043536 CACCCCGGGAAGCTGGAACTGGG - Intergenic
1069883635 10:71609604-71609626 GACTCTGGGCACCCGGCACTAGG + Intronic
1070702687 10:78615025-78615047 TAAGCTGGGAAGCAGGCACTTGG + Intergenic
1073435806 10:103514945-103514967 CAGGCTGGGCAGGTGGCTCATGG + Intronic
1074759297 10:116654487-116654509 AACCCTGGGGAGCTGGGACTGGG + Intergenic
1076726810 10:132417658-132417680 CCCGCTGGGCACCTGGCACCTGG + Exonic
1077216347 11:1396731-1396753 CCTGCTGGGCAGCCGGCACCAGG + Intronic
1080880344 11:36313865-36313887 CACTCTAGGCAGCATGCACTGGG + Intronic
1081866605 11:46363740-46363762 CAGGCTGGGCAGCTGTCACAGGG + Intronic
1081909938 11:46694298-46694320 CACCCTGGGGAGCTGGGAGTTGG - Intronic
1083721803 11:64607157-64607179 CAGGAGGGGCAGCTGGCAGTGGG + Exonic
1084274227 11:68043494-68043516 GACGGTGAGCAGCTGGCGCTGGG + Exonic
1084476757 11:69393806-69393828 CAGGGTGGGCAGCTGGCCCCAGG + Intergenic
1085242454 11:75069949-75069971 GACCCTGGGCAGCTGGGATTGGG - Intergenic
1086574102 11:88318512-88318534 CCAACTGGGCAGCTGACACTGGG + Intronic
1089161965 11:116445255-116445277 ACCTCTGGGCTGCTGGCACTGGG + Intergenic
1089565406 11:119368744-119368766 CAAGCTGGGCACCTGCAACTCGG - Intronic
1090339500 11:126004037-126004059 CATGCTGGGAAGCTGGCACACGG - Exonic
1090709941 11:129375412-129375434 CCCGCTGGGCTGCGGACACTGGG + Intergenic
1090839013 11:130473490-130473512 CACGCTGGGTGGCTGGCAGCTGG + Exonic
1092525890 12:9310181-9310203 CACACTGGGCAGCAGGCAGCAGG - Intergenic
1094511645 12:31100868-31100890 CACACTGGGCAGCAGGCAGCAGG - Intronic
1102997719 12:117362554-117362576 CACACTTGGCACCTGGCTCTGGG + Intronic
1104750131 12:131233117-131233139 CAGCCTGGGCAGCTGGCACGGGG - Intergenic
1104758527 12:131283455-131283477 CACACTGGGCAGATGGTCCTGGG - Intergenic
1104782585 12:131431344-131431366 CAGCCTGGGCAGCTGGCACGGGG + Intergenic
1104822166 12:131683536-131683558 CACACTGGGCAGATGGTCCTGGG + Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1105798793 13:23884543-23884565 CACGCTGGCCAGCTGACAGCGGG + Intronic
1106019158 13:25898673-25898695 CCAGCTGGGAAGCTGGAACTGGG - Intronic
1107604056 13:42040910-42040932 CACGCTGGGCTGCGGGCGCCGGG - Intronic
1109062145 13:57632845-57632867 CTCGAGGGACAGCTGGCACTTGG - Exonic
1113380914 13:109804990-109805012 CAGCCTGGGCAGCTTCCACTGGG - Intergenic
1113707001 13:112441506-112441528 CACGCAAGGACGCTGGCACTGGG - Intergenic
1113713633 13:112488485-112488507 CAGGCTGGGCAGCTGTCTCAGGG + Intronic
1115147159 14:30239105-30239127 CACAGTGGCCTGCTGGCACTTGG - Intergenic
1119555295 14:75548089-75548111 CAGGCAGGCCAGCAGGCACTTGG - Intergenic
1119614638 14:76091111-76091133 CACGTTGGGCACCTGGCAAAGGG - Intergenic
1119766960 14:77196273-77196295 CAAAGTGGGGAGCTGGCACTAGG - Intronic
1122129854 14:99598644-99598666 CTCTCTGGGCAGCAGGCACAGGG + Intronic
1122297545 14:100713848-100713870 CAGGCTGAGCAGCTGTCCCTGGG + Intergenic
1122706319 14:103624330-103624352 CACGGTGGCCTGCTGGCCCTGGG + Intronic
1122888078 14:104719411-104719433 CACGCTGGGCAGCTGGCACTGGG - Exonic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1128318774 15:66678285-66678307 CTCTTTGGGCAGCTGGCATTGGG - Intronic
1128706783 15:69842563-69842585 CTCCCTGGGAAGCTGGCACAGGG - Intergenic
1130827719 15:87566411-87566433 CACGCATGAAAGCTGGCACTGGG + Intergenic
1202955204 15_KI270727v1_random:71843-71865 CAGCCTGCGCAGCAGGCACTCGG + Intergenic
1133277534 16:4647881-4647903 CATGCTGGGCACCTGGCTCTGGG + Intronic
1136533944 16:30888105-30888127 CATCCTGGGCATCTGGCCCTGGG - Intronic
1136748638 16:32614046-32614068 GCCTCTGGGCAGCTGGCACGGGG + Intergenic
1136894511 16:33988799-33988821 CAGGCTTGGCAGATGGGACTTGG - Intergenic
1138197344 16:55061302-55061324 CATGTTGGGCAGCTGGCCCTGGG + Intergenic
1138440291 16:57030235-57030257 CAGGCTTGGCACCTGGTACTTGG + Intronic
1139436473 16:66939504-66939526 CAGACTGGGCAGCTGGCCCCTGG + Intronic
1139633571 16:68245052-68245074 CACGCTGCGCAGCTCTCACTTGG - Intergenic
1139848271 16:69935547-69935569 CACGCTGGCCGGCTGGCTCCTGG - Intronic
1140477388 16:75245657-75245679 CAGGCTGGGCACGTGGCACCAGG + Intronic
1140922585 16:79552700-79552722 CTTGCTGGGCAGCTGGTTCTGGG + Intergenic
1142400921 16:89858434-89858456 CACGCGGGGCCGCGGGCGCTGGG - Exonic
1203050771 16_KI270728v1_random:873260-873282 GCCTCTGGGCAGCTGGCACGGGG + Intergenic
1142697313 17:1640564-1640586 CAGGCAGGGCTGCTGGCACTGGG + Exonic
1142893325 17:2959107-2959129 CACTCTGGGAAGCTGGCAGGGGG + Intronic
1144218597 17:13079780-13079802 GAGGCTGGGCAGATGGCATTGGG - Intergenic
1145294124 17:21574714-21574736 TACGATGGCCAGCTGGCCCTTGG - Intergenic
1145369711 17:22298472-22298494 TACGATGGCCAGCTGGCCCTTGG + Intergenic
1145985783 17:29045277-29045299 CACTCTGGGCATCTGCCACACGG - Intronic
1146066769 17:29642195-29642217 CACATTGGTCAGCTGGCAGTAGG - Intronic
1147340421 17:39750437-39750459 CAGGCTGGGAAGCTGGGACCAGG + Intergenic
1149181380 17:53941440-53941462 CAAGCTGGCCAGTTGGCACATGG + Intergenic
1149554478 17:57563501-57563523 CAAGCTGGGAAGCGGGCTCTGGG + Intronic
1149866254 17:60152585-60152607 CACCCTTTGCAGCTGGCTCTTGG + Intronic
1150490814 17:65573186-65573208 CACCCAAGGCAGCGGGCACTGGG + Intronic
1150609947 17:66725987-66726009 CACTGTGGGCAGCTGGAGCTCGG + Intronic
1151470732 17:74316155-74316177 TACGGGGGGCAGCTGGCCCTGGG - Intergenic
1152230743 17:79112884-79112906 CAACCTGGGCAGCAGGCTCTCGG + Intronic
1152237692 17:79147073-79147095 CAGGCTGGGAACCTGGCACCGGG - Intronic
1152775608 17:82199828-82199850 GACACTGGGCAGGTGGCACACGG + Intronic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1156679995 18:39576732-39576754 CACAGTGGCCAGCTGGCACATGG - Intergenic
1157175976 18:45452702-45452724 CACTCTGTGGAGCTGGCAGTAGG + Intronic
1157339677 18:46768231-46768253 CATGCTGAGCAGCAGGCACTCGG - Intergenic
1161046090 19:2135831-2135853 CTTGCTGGGCAGCTGCCACCTGG + Intronic
1161452445 19:4354103-4354125 CATGCTGGGCAGCCGCGACTTGG + Exonic
1161801927 19:6421146-6421168 CACTCTGGTCAACTGGCACTGGG + Intronic
1162345826 19:10117408-10117430 CACGCTGTGTAGCTGTCACCTGG - Intronic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1166315279 19:41985887-41985909 TCCGCAGGTCAGCTGGCACTCGG + Exonic
1166354846 19:42220853-42220875 CAAGCTTTGCAGCAGGCACTGGG + Intronic
1167115734 19:47488153-47488175 CACAGTGGGCAGGTGGCACCGGG - Exonic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167688627 19:50971526-50971548 CAGGCTGGGGGGCTGGGACTTGG - Intergenic
1168712632 19:58510775-58510797 CACGCAGGTCAGCAGGCACTGGG + Exonic
925487526 2:4352337-4352359 CAGCCTTGGCAGCTGTCACTGGG - Intergenic
925751938 2:7096800-7096822 CATGGTGGGCTGCTGGCGCTTGG + Intergenic
926123379 2:10256661-10256683 CACGCCAGGCAGCTGCCTCTTGG - Intergenic
931634727 2:64331028-64331050 CAAGCTCCGCAGCAGGCACTAGG + Intergenic
932735895 2:74254380-74254402 CCCCCTGGGCAGCTAGCACATGG + Intronic
932836679 2:75044604-75044626 CAAGCTGGGCAGCTTGCAAGGGG - Intergenic
935137574 2:100321494-100321516 CAGCCTGCGCAGCCGGCACTCGG + Exonic
938082004 2:128375020-128375042 ATCGCAGGGCAGCTGGCGCTGGG + Intergenic
941887003 2:170538463-170538485 CACGCTGCGCCGGTGGCACTAGG - Intronic
942246728 2:174014816-174014838 CACCATGAGCAGCTGGCAGTTGG + Intergenic
942451656 2:176112093-176112115 CACGGGAGGCAGCAGGCACTCGG + Intronic
943031116 2:182687027-182687049 CCCGCTGGGAAGCTTGAACTAGG + Intergenic
945258281 2:207820577-207820599 CTAGCTGGCCACCTGGCACTTGG + Intergenic
946578358 2:221100822-221100844 CACCCTGGGCTGCGGGCTCTGGG - Intergenic
946683273 2:222240120-222240142 CTCCCAGGGCAGCAGGCACTCGG - Intronic
948829294 2:240590192-240590214 CAGGCTGGGCACCAGGCACCTGG - Intronic
1170940755 20:20846096-20846118 CACTCTGGGCACTGGGCACTGGG + Intergenic
1172056140 20:32155483-32155505 CACACTGGGCAGCTCACTCTTGG - Intronic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1173688230 20:44938951-44938973 CAGGCAGGGCAGCTGGCAAGAGG - Intronic
1174563123 20:51445293-51445315 CACGCTGGGGCCTTGGCACTGGG + Intronic
1174994522 20:55550970-55550992 AACACTGGCCAGCTGGCAGTGGG - Intergenic
1175198727 20:57264261-57264283 CACGCTGGGCACCTGGGGCGTGG - Intronic
1175728008 20:61332561-61332583 CACCCTGGGCAGCAGGCACTAGG + Intronic
1176308893 21:5139356-5139378 CACACTGGAGACCTGGCACTTGG - Intronic
1176448245 21:6840398-6840420 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1176826415 21:13705420-13705442 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1178584218 21:33859246-33859268 CACTCCGGGAAGCTGGCCCTAGG + Intronic
1179063664 21:38004073-38004095 CCCACTGGGGAGTTGGCACTGGG + Intronic
1179848168 21:44122677-44122699 CACACTGGAGACCTGGCACTTGG + Intronic
1182027636 22:27132945-27132967 CACCCTGGTCTGCTGGCTCTGGG + Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182351362 22:29701860-29701882 CGGGCTTTGCAGCTGGCACTGGG - Intergenic
1184901165 22:47447496-47447518 CACTCAGGGCAGGCGGCACTTGG + Intergenic
1185282828 22:49983039-49983061 CCCGCTGGGCAGCCTGCCCTCGG + Intergenic
951541147 3:23783259-23783281 CAAGCAGGGGAGCAGGCACTGGG + Intergenic
952959625 3:38581147-38581169 GCAGCTGGGCAGCTGGCCCTGGG + Exonic
954410409 3:50368107-50368129 CTGGCAGGGCAGCTGGCTCTGGG - Intronic
955060448 3:55488195-55488217 CTCGCTGGGCAGCTGCCGCACGG + Intronic
956382075 3:68675006-68675028 CACCTTGGGCTGCTGGCACAGGG - Intergenic
958673328 3:97232851-97232873 CACAGTGGCCTGCTGGCACTCGG + Intronic
961682567 3:128608683-128608705 GCTGCTGGGCAGCTGGCACATGG + Intergenic
963575240 3:147052724-147052746 GACGCTGGGCAGATGAGACTGGG - Intergenic
965104597 3:164340944-164340966 GACGCTGGGGAGCTGAGACTTGG - Intergenic
967019183 3:185507528-185507550 CACACTGGGCATCTGGCCCCAGG + Exonic
968485376 4:858436-858458 TGCCCTGGGCAGCCGGCACTGGG - Intronic
968798930 4:2729327-2729349 CACACTGGCCTGCTAGCACTTGG - Intronic
969057758 4:4412863-4412885 CTGGCTTGGCAGCTGTCACTGGG + Intronic
969453074 4:7286019-7286041 CCGGCGGGGCAGCTGGCTCTCGG - Intronic
969641661 4:8402332-8402354 CAAACTGGGCAGCTGGGCCTAGG - Intronic
969657529 4:8506857-8506879 CTGGCTGGGCTGCTGGCCCTCGG + Intergenic
972427600 4:38948804-38948826 CAGGCTTGGAAGCTGCCACTTGG + Intergenic
973863510 4:55088942-55088964 CATGCTGGACTGCTGGCACGGGG - Exonic
978778174 4:112523048-112523070 CTCGCTAGGCGCCTGGCACTCGG - Intergenic
985902322 5:2806253-2806275 TTCGCTGGGCTGCTGGCACTGGG + Intergenic
986733597 5:10652515-10652537 CACCATGGGAAGCTGTCACTGGG + Intergenic
990340071 5:54813442-54813464 CAGGCTGGGAAGCTCGAACTGGG + Intergenic
990948653 5:61275388-61275410 CAGGCTGGGCAGCAGACAGTAGG - Intergenic
991986514 5:72292573-72292595 CACCCTGAGCTGCTGGAACTTGG + Intronic
992175682 5:74146692-74146714 CAGGCTGTGATGCTGGCACTGGG + Intergenic
993393941 5:87358585-87358607 CATGCTGCGCAGCAGTCACTGGG + Intronic
997469753 5:134110626-134110648 GAGGCTGGGCTGCTGGCTCTCGG - Intergenic
999155322 5:149453670-149453692 CACCCTCAGCAGCTGGCACAGGG + Intergenic
999671217 5:153960518-153960540 CACGCTGGGCATGGGGCACAGGG - Intergenic
999693537 5:154168816-154168838 CAGGCCTGGCAGCGGGCACTGGG + Intronic
1003491848 6:6629158-6629180 CAAGCTGAGAAGCTGGCATTGGG + Intronic
1003877590 6:10452037-10452059 CACGCTGGAGAGCGGGCACTTGG - Intergenic
1006104902 6:31710628-31710650 CTCGCTGGCCATCTGGCACCTGG + Intronic
1006389871 6:33751924-33751946 CAGGCTGGGGACTTGGCACTGGG + Intergenic
1006965658 6:37981823-37981845 CACGTTGGGCACATGGCATTAGG - Intronic
1013136974 6:107291722-107291744 CACCGTGCCCAGCTGGCACTTGG - Intronic
1019179928 6:170180090-170180112 CAGGCTGGGAAGCTGGCAGAGGG + Intergenic
1022488025 7:30795220-30795242 CATGCTGGGCATCTAGCAATAGG + Intronic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1033261353 7:139846571-139846593 GACGCTGGGCAGCTAGATCTTGG + Intronic
1034193146 7:149226028-149226050 CACAGTGGGCAGCCGGCACCCGG + Exonic
1036811072 8:11868013-11868035 CAGGCTGGGCTGCAGGCTCTCGG - Exonic
1041319985 8:56603067-56603089 CACTCTAGGCAGCTGCCCCTTGG + Intergenic
1041625122 8:60016426-60016448 CAGGCTGGTGAGCTGGCTCTTGG - Intergenic
1041914836 8:63128275-63128297 CCCGCTGGGCCTCAGGCACTGGG + Intergenic
1044003718 8:86916425-86916447 CACACTGGCCTGCTAGCACTTGG + Intronic
1044363074 8:91310744-91310766 CACACTGGCCTGCTAGCACTTGG - Intronic
1049454383 8:142679615-142679637 AAAGGTGGGCAGCTGGAACTGGG + Intronic
1049603925 8:143520416-143520438 CAGGGTGGGCAGCTGGCCATCGG - Intronic
1049716000 8:144092470-144092492 CACCTCAGGCAGCTGGCACTGGG + Intergenic
1049804599 8:144533188-144533210 CACCCAGGGCAGCTGGCGCTCGG + Exonic
1050377101 9:4984961-4984983 CACGCAGGGCAGCTGCCTCTCGG - Intergenic
1054834737 9:69665230-69665252 CACGGTGGGCAGCTGAGGCTTGG - Intronic
1056955123 9:91075331-91075353 CACGCTGGGCAGCAGCCAGAGGG - Intergenic
1057268158 9:93632231-93632253 CTCCCTGGGCAGCTGGCCGTAGG - Intronic
1057548005 9:96032291-96032313 CATGTTGGGCAGCTGCCGCTAGG + Intergenic
1061216050 9:129222623-129222645 GTCACTGGGCAGCTGGCAATGGG - Intergenic
1062520117 9:136954277-136954299 CATGCTGGGCAGTAGGCACGGGG + Intronic
1062733555 9:138122067-138122089 CACACGGGGCAGCCGGCCCTCGG + Exonic
1203520946 Un_GL000213v1:44120-44142 CAGCCTGAGCAGCGGGCACTTGG + Intergenic
1186682537 X:11891016-11891038 CCAGCTGGGCAGCTGCCTCTTGG + Intergenic
1195656052 X:107332484-107332506 CCTGCTGGGCTGCTGGAACTAGG - Intergenic
1195954824 X:110317932-110317954 CGAGCTGGGGAGCTGGGACTAGG - Exonic
1197648570 X:129041964-129041986 CCTGCTGGTCAGCTGGCAGTGGG - Intergenic
1199742077 X:150745234-150745256 CAGGTTGCGCAGCAGGCACTGGG - Intronic
1200116887 X:153773387-153773409 CACCCCCGGAAGCTGGCACTGGG - Exonic
1201943360 Y:19483310-19483332 CACATAGGGCAGATGGCACTAGG - Intergenic