ID: 1122888100

View in Genome Browser
Species Human (GRCh38)
Location 14:104719485-104719507
Sequence AGTGAGGGGGCAGCGGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888100_1122888107 -7 Left 1122888100 14:104719485-104719507 CCAGCAGCCGCTGCCCCCTCACT 0: 1
1: 0
2: 2
3: 43
4: 429
Right 1122888107 14:104719501-104719523 CCTCACTGCCCACCCAGCGAGGG 0: 1
1: 0
2: 0
3: 33
4: 206
1122888100_1122888113 22 Left 1122888100 14:104719485-104719507 CCAGCAGCCGCTGCCCCCTCACT 0: 1
1: 0
2: 2
3: 43
4: 429
Right 1122888113 14:104719530-104719552 ACCCGAGCCTGCCCCCTGCCAGG 0: 1
1: 0
2: 5
3: 34
4: 318
1122888100_1122888105 -8 Left 1122888100 14:104719485-104719507 CCAGCAGCCGCTGCCCCCTCACT 0: 1
1: 0
2: 2
3: 43
4: 429
Right 1122888105 14:104719500-104719522 CCCTCACTGCCCACCCAGCGAGG 0: 1
1: 0
2: 1
3: 27
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888100 Original CRISPR AGTGAGGGGGCAGCGGCTGC TGG (reversed) Exonic
900002684 1:23479-23501 AGTGAAGGAGCAGGGGCTCCAGG + Intergenic
900150118 1:1174727-1174749 CGTGAGGAGCCAGCGGCTCCCGG + Intronic
900253721 1:1685514-1685536 AGTGAGGTGGGGGCGGCTCCAGG + Intronic
900759555 1:4461831-4461853 AGGGAGGCGGCAGCTGCTCCTGG - Intergenic
900947854 1:5841280-5841302 ACCGTGGGGGCAGGGGCTGCTGG - Intergenic
900981303 1:6047720-6047742 GGTCAGGGGGCAGTGGCAGCAGG + Intronic
901192148 1:7418984-7419006 AGTGAGGCAGGAGCTGCTGCAGG - Intronic
901404123 1:9034529-9034551 AGAGAGGTGGCAGGGGCTGCGGG - Intergenic
901624488 1:10616252-10616274 CATGAGGGGGAAGGGGCTGCTGG - Intronic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901843305 1:11966727-11966749 AGGGAGGGGGCAGAGGCCCCAGG - Intronic
902203760 1:14852505-14852527 AGGGAGGGGGCAGGGCCTGCAGG - Intronic
902920923 1:19665562-19665584 GGTCAGGGGGCAGCGACTACAGG - Exonic
903193551 1:21669396-21669418 AGTGAGTGGGGAGCGGCGCCGGG - Intergenic
903302631 1:22390224-22390246 AGAGGTGGGGCAGAGGCTGCAGG + Intergenic
904614225 1:31741451-31741473 ACTGAGGAGACAGCGGCGGCTGG + Exonic
905019306 1:34797495-34797517 GGTGAGAGGCCAGAGGCTGCAGG + Intronic
905515585 1:38559608-38559630 AGGGAGGTGGAAGCGGCTTCCGG + Intergenic
905630856 1:39517804-39517826 ACTGAGAGGGGAGAGGCTGCCGG + Intronic
905666903 1:39768368-39768390 ACTGAGAGGGGAGAGGCTGCCGG - Intronic
905723604 1:40228911-40228933 ACTGAGGAGGCAGAGGCAGCGGG - Intronic
905876218 1:41433452-41433474 AGTGAGGGGCCCTGGGCTGCAGG - Intergenic
907191149 1:52650046-52650068 AGTATAGGGGCAGCTGCTGCAGG - Intronic
907443125 1:54490543-54490565 AGGGAGGGAGGGGCGGCTGCAGG - Intergenic
908296736 1:62720111-62720133 ACTGAGGAGGCAGAGGCTGGAGG + Intergenic
908616188 1:65925516-65925538 AGTGATGGGGCAGGGGCTCGGGG - Intronic
908650960 1:66332461-66332483 AGTTAGGCTGGAGCGGCTGCAGG - Intronic
909583164 1:77260783-77260805 AGCGAGGGGGCAGGGACTGGGGG - Intergenic
909595882 1:77405747-77405769 AGTGAGGGGACTTCAGCTGCTGG - Intronic
911567021 1:99474186-99474208 GGGGTGGGGGCAGAGGCTGCTGG - Intergenic
911647680 1:100353101-100353123 AGAGCGCGCGCAGCGGCTGCAGG - Intronic
915476896 1:156158312-156158334 AGTGAGGGGGCAGCCTCTGGGGG + Intronic
915724468 1:158007803-158007825 AGCGAGGGCACAGGGGCTGCTGG - Intronic
916747694 1:167697282-167697304 AGTGAGGGAGCAGCGGGAGAGGG + Exonic
916913830 1:169384352-169384374 AGTGAGGGGGCAACTGCAGTGGG - Intronic
917655287 1:177119878-177119900 ACTGAGGGGGCAGCCTCTGCTGG - Intronic
919166778 1:193905558-193905580 AGGCAGGGAGCAGCTGCTGCAGG + Intergenic
920671191 1:208004703-208004725 CCTGAGGGTGCAGTGGCTGCTGG + Intergenic
922370138 1:224901651-224901673 AGTGAGGAAGCAAAGGCTGCCGG - Intronic
923118766 1:230970368-230970390 AGGGATGGGGCAGTGGCTGGAGG + Intronic
923339615 1:232996252-232996274 AGTCAGGGGGGTGTGGCTGCGGG - Intronic
923586364 1:235276027-235276049 AGTGAGGGGGCTGAGGCAGAAGG + Intronic
924423627 1:243931602-243931624 GGGGAGGGCGCAGCGGCTACAGG - Intergenic
924510762 1:244727633-244727655 AGGGAGGGGGCAGTGGCAGAAGG + Intergenic
924940935 1:248812138-248812160 ATTGAGGGGGCCGAGGGTGCGGG - Exonic
1063478155 10:6346757-6346779 ACTCAGGGGGCAGGGACTGCTGG + Intergenic
1063995052 10:11611395-11611417 CGTGAGGGGCCGGCGGCGGCGGG - Intronic
1066022756 10:31319539-31319561 AGGGAGGCGGCAGGGGCGGCGGG - Intronic
1066461522 10:35616576-35616598 AGTGAGGGGGCAGTGCCTGAGGG - Intergenic
1067066008 10:43104701-43104723 AGTGAGGACGCAGCTGCAGCAGG + Intronic
1067382429 10:45787375-45787397 ATGGAGGGGGGAGCGGCTGAAGG - Intronic
1067569596 10:47361572-47361594 AGTAAGGGGTCACCGGCTGGTGG + Intergenic
1067698915 10:48554773-48554795 AGTGAGTGGGTTGCTGCTGCAGG - Intronic
1068404735 10:56574373-56574395 AGTGATGGGGGTGCTGCTGCAGG + Intergenic
1069635613 10:69923060-69923082 AGTCAGGGCGCAATGGCTGCAGG + Intronic
1069949251 10:72008036-72008058 AGAGGAGGTGCAGCGGCTGCGGG + Exonic
1070118265 10:73550247-73550269 AGTGAGGGGCCAGCTGGTGTAGG - Intronic
1071966598 10:90858122-90858144 AGGGAGCGGGCAGCGGCCGGAGG - Intergenic
1072370895 10:94765637-94765659 AGTGGTGGGGGAGCTGCTGCAGG + Intronic
1072802481 10:98402722-98402744 GGTGAGGGGGCAGGGAGTGCGGG - Intronic
1074893617 10:117755949-117755971 AGTGAGGGGGTGGGGGCTGGAGG - Intergenic
1075088476 10:119429800-119429822 CAGGAGGGGGCAGAGGCTGCTGG - Intronic
1075430324 10:122374866-122374888 CGCGAGGTGGCGGCGGCTGCGGG + Intronic
1075536317 10:123275035-123275057 AGGGAGGGGGCAGGGGCTGGCGG + Intergenic
1075663788 10:124216538-124216560 AGGAAGGGTGCAGAGGCTGCTGG + Intergenic
1075704960 10:124494968-124494990 AGTGAGGGGACACCGGGTCCTGG - Intronic
1076156112 10:128206982-128207004 AGTGAGGTGGGTGAGGCTGCTGG + Intergenic
1076760913 10:132605358-132605380 AGTGAGGGGGAAGCGGCTGGGGG + Intronic
1076882719 10:133247459-133247481 AGTCAGGAGGCAGGTGCTGCTGG + Intergenic
1077249297 11:1553988-1554010 AGGGTGGGGGCAGAGGCTGCTGG - Intergenic
1077476075 11:2791229-2791251 AGTGAGGGCTCGGCCGCTGCGGG - Intronic
1077962483 11:7089705-7089727 GGCGCGGGGGCAGCGGCTCCCGG - Exonic
1078180243 11:9004574-9004596 GGGGAGGGGGCAGCCGGTGCAGG + Intergenic
1080422840 11:32126931-32126953 ATTGGGGTGGCAGGGGCTGCTGG - Intergenic
1080592878 11:33738762-33738784 AGAGAAGGGGCAGGGGATGCAGG - Intergenic
1080628606 11:34052496-34052518 AGTGAGGCGGCCGCGGGAGCCGG + Exonic
1081907933 11:46680989-46681011 AGTGAGGCGGGTGCGGCGGCTGG - Exonic
1081957752 11:47108301-47108323 AGTGAGGGGACAGTGTCTCCTGG - Intronic
1083270083 11:61567796-61567818 GGTGAGGGGGCGGCGGGGGCCGG - Intronic
1083285581 11:61656598-61656620 GGTGAGGGTGCAGGGGGTGCAGG + Intergenic
1083678599 11:64341198-64341220 AGTGCGGGGGCAGAGGCAGGAGG - Intronic
1083702826 11:64490924-64490946 AGAGAGGGTGCAGTGGGTGCAGG - Intergenic
1083869243 11:65477074-65477096 AGTGAGGGAGCAGAGGATGAAGG + Intergenic
1084264596 11:67998285-67998307 AGTGAGGGCCCAGTGTCTGCTGG + Intronic
1084549838 11:69834675-69834697 AGGGAGGTGGGAGCAGCTGCAGG - Intergenic
1084970757 11:72770802-72770824 AGGGAGGGGGAAGGGGCTCCCGG + Intronic
1086397444 11:86431537-86431559 CGTGGCGGGGCAGCGGCGGCAGG - Intergenic
1089612294 11:119676311-119676333 TGTGAGTGGGCAGAGCCTGCTGG - Intronic
1089941890 11:122427443-122427465 AGAGATGGGGCAGCAGGTGCGGG + Intergenic
1090618575 11:128540755-128540777 AGTGAGGGAGCAGCGGTCCCAGG + Intronic
1091280320 11:134378057-134378079 ACTGACGGGGCGGGGGCTGCTGG - Intronic
1091280579 11:134379652-134379674 AAAGAGGGGGCAGGGGCTGCTGG - Intronic
1091376101 12:25542-25564 AGTGAAGGAGCAGGGGCTCCAGG + Intergenic
1092528982 12:9328622-9328644 AATGAGGGCGGTGCGGCTGCAGG + Intergenic
1092704270 12:11267273-11267295 CGGGAGGTGGCAGAGGCTGCTGG + Exonic
1093650752 12:21642797-21642819 AGTGTGGGGGTGGAGGCTGCAGG - Intronic
1093654067 12:21674944-21674966 AGGGAGGGGACAGGGGCTGAAGG + Intronic
1093885144 12:24450933-24450955 AGTGAGGGGGTAGGGGAAGCAGG - Intergenic
1094041704 12:26126068-26126090 AGTGATGTGGCAGCAGCGGCAGG - Intronic
1094354847 12:29566342-29566364 AGTAAGGGGGCAGGTGGTGCAGG + Intronic
1096882642 12:54685325-54685347 GGTGAGGGGGCAGTGGTTGCAGG - Intergenic
1096975856 12:55698985-55699007 AGGGAGGGGGCAGGGGCTGGGGG - Intronic
1097187053 12:57201691-57201713 AGTGAGGGAGCAGCCACTGAGGG - Intronic
1097929819 12:65170551-65170573 AATGACAGGGCGGCGGCTGCCGG + Exonic
1100359251 12:93861151-93861173 GCTGAGGGAGCAGAGGCTGCAGG + Intronic
1101569198 12:105937395-105937417 AGAGATGGGGCAGCTGCTGGAGG + Intergenic
1102208609 12:111107619-111107641 GGTGAGGGAGCAGAGGGTGCAGG + Intronic
1103703624 12:122860210-122860232 GGTGAGGGGCCGGCGGCAGCAGG + Exonic
1103778587 12:123384271-123384293 GGGGTGGAGGCAGCGGCTGCGGG + Intronic
1103909082 12:124342059-124342081 AGGTAGTAGGCAGCGGCTGCGGG + Exonic
1103986212 12:124769070-124769092 AGTGAGGGGAGAGAGGCTGAAGG + Intergenic
1104909839 12:132235441-132235463 TGTTGGGGGGCACCGGCTGCGGG + Intronic
1105208205 13:18241002-18241024 TGTGGGAGGGCAGGGGCTGCTGG + Intergenic
1105535194 13:21259360-21259382 GGTTAGGGAGCAGCGGCTGGGGG + Intergenic
1106549917 13:30762197-30762219 AGTGTGGGGGCTGATGCTGCTGG + Intronic
1106590001 13:31090736-31090758 ACGGAGGGGGCAGCTGCTGATGG - Intergenic
1109971026 13:69769633-69769655 AATGAGGAGGCACAGGCTGCAGG - Intronic
1110913205 13:80989720-80989742 AGTGGGGAGGCAGAGGCTACAGG + Intergenic
1111253713 13:85639239-85639261 AGTGTGGCTGCAGCGGCAGCTGG + Intergenic
1111940496 13:94601927-94601949 CATGGGGGGGCTGCGGCTGCTGG + Exonic
1115961472 14:38838630-38838652 TGTGTGGGGGCAGGGGCTCCTGG - Intergenic
1116164947 14:41323400-41323422 AGGGAGGGGACAGGGGCTGAAGG + Intergenic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1118296276 14:64572861-64572883 AGTGAGGGTGGAGCTGCTGAAGG + Intronic
1118717345 14:68569784-68569806 AGTGGGAAGGCAGAGGCTGCTGG - Intronic
1119004092 14:70908221-70908243 AGTGAGCGGGCGGGGGCGGCCGG - Intronic
1120904666 14:89609890-89609912 AGGGCGGGGGCGGCGGCGGCTGG + Intronic
1121915395 14:97833109-97833131 AGGGAGGGGGCAGAAGCTGCTGG + Intergenic
1122414090 14:101540577-101540599 AGTGTGGGAGCAGAGGCTGCCGG + Intergenic
1122422849 14:101588370-101588392 AGGGAGGGGGAAGGGGCTCCAGG - Intergenic
1122888100 14:104719485-104719507 AGTGAGGGGGCAGCGGCTGCTGG - Exonic
1122925642 14:104898238-104898260 AGTGAGGGCACAGGGGCTGCGGG + Intergenic
1123024960 14:105420114-105420136 GGGGAGGCGGCAGCGGCGGCGGG - Intronic
1123036007 14:105472210-105472232 AGTGAGTGGGTACCGGCTGGGGG + Intergenic
1124249746 15:28099014-28099036 GCTCAGGGGGCAGCTGCTGCAGG + Intronic
1124370745 15:29103540-29103562 AGTGACGGGGAGGCGGCGGCTGG + Intronic
1125744284 15:41988189-41988211 AGTGTGGGGCCTGGGGCTGCAGG - Intronic
1125879991 15:43185517-43185539 AGGGTGGGGACTGCGGCTGCAGG - Exonic
1125968549 15:43893694-43893716 GGTGTGGGGGCTGAGGCTGCTGG + Intronic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1126709920 15:51443884-51443906 AGTGAGGGGCCTGGGGCTGCAGG + Intergenic
1127790315 15:62392524-62392546 AGTGAGGGGGAAGCGGGAGTGGG + Intronic
1127841131 15:62833066-62833088 AGTTAGGGGGAAGGGGCTGCAGG + Intronic
1128254426 15:66186345-66186367 AGAGAGGGCCCAGGGGCTGCTGG - Intronic
1128527346 15:68421548-68421570 AGTGAGGGGGCTGTGGCCACAGG + Intronic
1128683988 15:69670437-69670459 AGGGATGGGGCAGAGGCAGCAGG + Intergenic
1129644706 15:77419739-77419761 AGGGAGGGGGCAGGGGCGGCAGG + Intronic
1130981152 15:88812538-88812560 AGTGAGAGGCCAGGGGCTGCAGG - Intronic
1132450827 15:101967460-101967482 AGTGAAGGAGCAGGGGCTCCAGG - Intergenic
1132573319 16:653484-653506 AGGGAGGGTGTAGGGGCTGCAGG - Intronic
1132606948 16:797534-797556 AGTGAGGGGTGAGGGGCAGCTGG + Intronic
1132788817 16:1673506-1673528 AGTGAGGGGACAGAGAGTGCCGG - Intronic
1133451048 16:5904348-5904370 AGTGATGGAGCAGCCTCTGCTGG - Intergenic
1135390973 16:22092868-22092890 AGTGAAGGGGCAGCGACAGGAGG + Intronic
1136492141 16:30615614-30615636 TGTGTGGGGGCAGCTGGTGCTGG + Intronic
1137280655 16:46973672-46973694 AGCGAGGGGGAAGCGGGGGCGGG + Exonic
1137451468 16:48578317-48578339 GGTGAGGGGGCAAGGGGTGCAGG - Intronic
1137464736 16:48697836-48697858 ACTGAAGGGGCAGGGGCTGTTGG + Intergenic
1137709928 16:50559576-50559598 AGGGAGTGGGCAGTGCCTGCTGG + Intronic
1137788389 16:51154779-51154801 AGTGAGGCGGCAGCTGCGCCGGG + Intergenic
1138150190 16:54649713-54649735 ATTGAGGAGGGAGAGGCTGCTGG + Intergenic
1139631166 16:68232735-68232757 AGTGTGGGAGCAGGGGCTGGGGG - Intronic
1140033897 16:71358801-71358823 GGTAAGGGGGCTGCTGCTGCGGG - Exonic
1140221734 16:73048527-73048549 AGCGAGGGGTCAGCGCCTCCGGG - Intronic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1141015172 16:80442033-80442055 AGTGGTGGTGCAGCTGCTGCAGG + Intergenic
1141141049 16:81497092-81497114 AGTGATGGGGCAGCTGGAGCTGG + Intronic
1141222437 16:82083715-82083737 AGTGACGGGGCAGAGGATGAAGG - Intronic
1141809023 16:86361815-86361837 AGTGAGGGAGCAGTGGAAGCAGG - Intergenic
1141984325 16:87570343-87570365 AGTGAGGGGCCCGAGGCTGTGGG - Intergenic
1141985396 16:87576559-87576581 AGTGAGGGGGCACCTGGTCCAGG + Intergenic
1142045033 16:87919792-87919814 AGGCAGGGGGCAGCGGCGGGTGG + Intronic
1142316615 16:89351185-89351207 AGAGAGGCGGCGGCGGCAGCTGG + Intronic
1142316694 16:89351722-89351744 AGAGAGGACGCAGAGGCTGCAGG + Intronic
1143166706 17:4900528-4900550 AGTTAGGGGCCAGAGGCGGCGGG + Exonic
1143522845 17:7455343-7455365 AGTGAGGGGGCTCCGGCATCAGG - Exonic
1143547863 17:7610148-7610170 AGCCAGGAGGCAGAGGCTGCAGG + Intronic
1144046938 17:11462416-11462438 AGGGAGGGGTCAGCTGTTGCCGG - Intronic
1144658468 17:17052969-17052991 AGGGAAGGGGGAGCAGCTGCAGG + Intronic
1144829752 17:18124565-18124587 AGTGAGTGGGCAGGGCCGGCGGG + Exonic
1145026398 17:19471006-19471028 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145276909 17:21437016-21437038 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145296669 17:21598407-21598429 AGTGAGGGGACAGTGGCTGTTGG - Intergenic
1145314741 17:21722909-21722931 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145367110 17:22273671-22273693 AGTGAGGGGACAGTGGCTGTTGG + Intergenic
1145713183 17:26994846-26994868 AGCCTGGGGCCAGCGGCTGCAGG - Intergenic
1145828217 17:27893258-27893280 GGCGCGGGGGCAGCGGCGGCCGG - Intronic
1147604570 17:41767291-41767313 AGTAAGGGGGCAGCGGCCCAAGG + Intronic
1147657522 17:42099084-42099106 AGGGAGGGGGCAGGGGCTCAGGG - Intergenic
1148075721 17:44934301-44934323 TGCGAAGGGGGAGCGGCTGCGGG - Exonic
1148089716 17:45016014-45016036 GGGAAGGGGGCAGTGGCTGCAGG - Intergenic
1148122663 17:45222014-45222036 GGCGAGGGGGCAGCGGCTGGCGG - Exonic
1148155704 17:45424358-45424380 AGTGAGAGGTCAGTGGCTGTTGG - Intronic
1148326402 17:46785769-46785791 AGTCAGAGGGAAGAGGCTGCGGG + Intronic
1148860276 17:50600964-50600986 ACTGGAGGGGCAGGGGCTGCGGG + Intronic
1149626789 17:58085139-58085161 AATGTGGGGGCAGAGGGTGCTGG + Intronic
1150692762 17:67378913-67378935 GGTGCCGGGGCCGCGGCTGCCGG + Intronic
1151467900 17:74299624-74299646 AGAGAGGGGGCTGCTGCTTCTGG - Intronic
1152385971 17:79974990-79975012 ATAGAGGGCGCAGTGGCTGCGGG - Intronic
1152785402 17:82245358-82245380 AGTGAGTGGGCTGCGGCTGGAGG + Intronic
1153687842 18:7564933-7564955 ATTGAGAGGGCAGAAGCTGCTGG + Intergenic
1153959402 18:10127813-10127835 TGTGAGGGGTCAGCAGCTGCTGG - Intergenic
1153999961 18:10474460-10474482 AGTGAGGAGGCAGGTGCGGCTGG + Intronic
1156095861 18:33531059-33531081 AGGGAGGTGGCATTGGCTGCTGG + Intergenic
1156744577 18:40373291-40373313 AATGAGGAGGCAGGGGTTGCGGG + Intergenic
1158402204 18:57131264-57131286 AGTGAGCTGGCAGGGACTGCGGG - Intergenic
1158944482 18:62436781-62436803 AGGGAGGGAGCAGCGGTTTCAGG - Intergenic
1159170110 18:64755555-64755577 AATGAGAGGGCAGCCGGTGCAGG - Intergenic
1160439481 18:78878446-78878468 AGTGAGGGGGCAGAGAAGGCAGG - Intergenic
1160517771 18:79487985-79488007 AGGGAGTGGGCAGTGGCTCCAGG - Intronic
1160634435 19:65087-65109 AGTGAAGGAGCAGGGGCTCCAGG + Intergenic
1160752560 19:741392-741414 AGTGAGGGGAGACGGGCTGCAGG + Intronic
1160789545 19:917242-917264 AGGGAGTGGCGAGCGGCTGCCGG + Intergenic
1160844277 19:1159684-1159706 AGTGGGGGGGCAGCGGCGGATGG + Intronic
1160906070 19:1452247-1452269 AGGGATGGGGCAGGGGCTGCCGG + Exonic
1160914377 19:1489828-1489850 AGTGCGGGGTCAGGGACTGCTGG + Exonic
1161399565 19:4061360-4061382 GGGGAGGGGGCGGGGGCTGCCGG - Intronic
1162292713 19:9791947-9791969 AGTGAGGGGGAGGCGGGGGCGGG - Intronic
1162914074 19:13865180-13865202 AGGGAGGGGGCGGCGGCAGCGGG + Intronic
1163138765 19:15332330-15332352 GGGGAGGGGGCGGCGGCAGCGGG - Intronic
1163442458 19:17328771-17328793 AGGGCGGGGGCGGCGGCAGCGGG - Exonic
1163674145 19:18646952-18646974 AGGGCGGGGGCAGGGGCGGCGGG + Intronic
1165408373 19:35643845-35643867 AGTGAGGGGGCGGGGGCTTAGGG + Intronic
1165452036 19:35889457-35889479 AGTGAAGGGAAAGGGGCTGCTGG + Intronic
1165460120 19:35939452-35939474 AGGCAGGGGCCAGCGGCAGCAGG - Exonic
1165713439 19:38028313-38028335 AGTGAGGGGCAAGCGGTGGCAGG - Intronic
1166310540 19:41959909-41959931 AGTGAGGGGGCCATGGTTGCTGG + Intergenic
1166365858 19:42278173-42278195 AGGGAGGTGGCAACGGCAGCTGG - Intronic
1166524893 19:43504674-43504696 CGTGAGGGGGCCGAGGCTGTGGG - Exonic
1166829905 19:45632956-45632978 CGTGGGGCGGCAGCGGCTGCAGG + Exonic
1166852838 19:45768666-45768688 GGGGCGGGCGCAGCGGCTGCGGG - Exonic
1166852850 19:45768693-45768715 GGTGAGGCGGCGGCGGCGGCCGG - Exonic
1167135456 19:47612876-47612898 AAGGAGGGGACAGTGGCTGCGGG - Intronic
1167166439 19:47802847-47802869 GGTGCGGAGGCAGAGGCTGCAGG + Exonic
1167376584 19:49115234-49115256 GGTGAGGAGGCAGCGGCATCAGG - Intronic
1167413702 19:49359966-49359988 AGTGAGGGGGCTGGGGGTGACGG - Exonic
1167454529 19:49591460-49591482 AGGGAGGGGGCAGGGGCGGAGGG - Intergenic
1167574123 19:50309633-50309655 GGTGAGGGGGCCGCGTCTGTGGG - Exonic
1167578945 19:50330921-50330943 AGGGAGGAGGCGGCGCCTGCGGG + Intronic
1167784762 19:51627808-51627830 AGTGTGGGGGCAGCTGGAGCAGG - Intronic
1167793469 19:51694446-51694468 AGGGAGGGAGCAGGGGCTGGGGG - Intergenic
1168072510 19:53960798-53960820 AGCCACGGGGCAGCGGGTGCAGG + Intergenic
1168250327 19:55137905-55137927 TCTGAGGGGGCAGGGGCTGGGGG - Intronic
925042771 2:746434-746456 AGGGAGCGTGCAGCTGCTGCTGG - Intergenic
925169689 2:1743514-1743536 AGCGGGGGCGCCGCGGCTGCGGG + Intronic
925180287 2:1813155-1813177 ATTGAGGGGCCAGGAGCTGCAGG + Intronic
926364029 2:12116420-12116442 AGTGAGGGGGGAGGGGGTGGAGG - Intergenic
926889287 2:17625655-17625677 AGTTAGGAGGCAGGGGCTGGGGG + Intronic
926914158 2:17877620-17877642 GGTGAGTGGTCAGCGGGTGCTGG + Intergenic
927135207 2:20091957-20091979 AGTGAGGGAGCAGCTGCGCCCGG + Intergenic
927962164 2:27247619-27247641 AATGAGGGGGCATTGGCTGGTGG + Intergenic
929778342 2:44942235-44942257 CGGGAGGCGGCAGCGGCGGCGGG + Exonic
929997345 2:46836965-46836987 AATGTGGGGGCAGCGGCTAGAGG + Intronic
930153510 2:48081436-48081458 ACTGAGATGTCAGCGGCTGCAGG + Intergenic
930154209 2:48089085-48089107 AGTGAGGGGGCAGCAGGGGTGGG + Intergenic
931711061 2:64989323-64989345 AGTGAGCGGGCTGGGGCCGCTGG + Intronic
933803843 2:85983928-85983950 GGAGAGGGGGCAGAGGCTGATGG - Intergenic
934027178 2:88010778-88010800 AGGGAGGGGACAGGGGCTGAAGG - Intergenic
934034434 2:88077289-88077311 AGTGAGAGGGGACCAGCTGCTGG + Intronic
934555784 2:95286487-95286509 TGTGCTGGGGCAGCGGCTGCAGG + Exonic
934753918 2:96812059-96812081 AGTGAGAGGGACGTGGCTGCTGG + Intergenic
937128193 2:119487897-119487919 TGTGTGGGGGGAGGGGCTGCTGG - Intronic
937329676 2:121018795-121018817 AATGAGGGGGCGGAGGCAGCAGG + Intergenic
937929156 2:127191485-127191507 CGGGAGGGTGCAGTGGCTGCGGG + Intronic
941688969 2:168478538-168478560 GGTGATGGGGCAGAGGCTGATGG - Intronic
942153947 2:173107440-173107462 GGTGAGGGGGCAGCCGGAGCCGG + Intronic
942265767 2:174224268-174224290 CGAGAGGGGGCAGTGGATGCTGG - Intronic
943369958 2:187003414-187003436 AGCGCGGGGGCAGCAGCAGCAGG - Intergenic
944743788 2:202635809-202635831 AGCAAGGGGGAGGCGGCTGCGGG + Intronic
945141672 2:206693218-206693240 AGCGAGAAGGCAGCAGCTGCTGG - Exonic
945802504 2:214450703-214450725 AGTCAGGGGGCAACAGGTGCTGG + Intronic
946322458 2:218961735-218961757 GGTGTGGGGGAAGGGGCTGCCGG + Exonic
946326163 2:218985596-218985618 AGGGAGGGGGCTGTGGCTGCTGG - Exonic
947878842 2:233486917-233486939 AAGGAGGGGACAGAGGCTGCTGG + Intronic
948168025 2:235878125-235878147 AGTATGGGTGCTGCGGCTGCTGG + Intronic
948217154 2:236240266-236240288 AGTGAGGCGGTGGGGGCTGCAGG - Intronic
948449477 2:238060524-238060546 AGTGCCGGGGCCGCGGCAGCAGG - Intronic
1169345170 20:4823370-4823392 AGTGGGGGCGCCGCGGCTGGGGG + Intronic
1171013184 20:21519608-21519630 AATGCGGGAGCAGGGGCTGCAGG + Intergenic
1172891788 20:38271031-38271053 TGGGAGGGGGCAGGGGCTACAGG + Intronic
1173402733 20:42739508-42739530 AGGGAAGGGGCAGAGGCTGGCGG + Intronic
1173471475 20:43326559-43326581 AGTGGGGGAGGAGTGGCTGCAGG - Intergenic
1173614786 20:44395536-44395558 AGTGGGGTGGCTGTGGCTGCAGG + Intronic
1173632664 20:44528338-44528360 ACTGGGGAGGCAGAGGCTGCAGG + Intergenic
1174081677 20:47974439-47974461 ATAGAGGGGGCAGAGGCTGCGGG - Intergenic
1174134789 20:48372180-48372202 ATAGAGGGGGCAGAGGCTGCGGG + Intergenic
1174199892 20:48799800-48799822 GGTGAGGGGGCAGGGGCTGCGGG + Intronic
1175294773 20:57900647-57900669 AGTGTTGGGGCAGGGGCTTCAGG + Intergenic
1175407173 20:58742786-58742808 AGGGAGGAGGCAGCAGCTGCAGG + Intergenic
1175483966 20:59331518-59331540 AGAGAGGGGGGAGCAGCTGCAGG - Intergenic
1175690995 20:61065930-61065952 AGAGATAGGGCAGCCGCTGCAGG + Intergenic
1175816134 20:61884133-61884155 AGTGAGAGGGGAGGGTCTGCTGG + Intronic
1176026148 20:62986569-62986591 GGTGATGGGGCAGAGGGTGCAGG + Intergenic
1176037365 20:63046242-63046264 AGTCTGGGGACAGCGGCTCCTGG - Intergenic
1176144635 20:63560117-63560139 AGGGTGGGCGCAGCGGCAGCAGG - Intronic
1176150840 20:63590006-63590028 AGGGAGCGGGCAGAGGCCGCAGG - Exonic
1176281577 20:64316620-64316642 TGGGAGCGGGCAGCGGCGGCGGG + Intergenic
1176284656 21:5012954-5012976 ACTGAGGGGGCAGGGGCAGGAGG - Intergenic
1176297609 21:5082662-5082684 AGTGGGCAGGCAGGGGCTGCTGG + Intergenic
1176371376 21:6063860-6063882 AGTGTGGGGGAGGCGGGTGCGGG - Intergenic
1178076697 21:29019210-29019232 AGTGAGGGGGCCACGGCTCAAGG - Exonic
1178524991 21:33320175-33320197 ACTGAGGAGGCAGAGGTTGCTGG + Intergenic
1178923075 21:36752196-36752218 CGTGAGGGAGGAGCGCCTGCTGG + Exonic
1179659035 21:42862950-42862972 AGTGGGGTGACAGGGGCTGCTGG + Intronic
1179674854 21:42974487-42974509 AGAGAGGGGGCGGGGCCTGCCGG - Intergenic
1179732647 21:43376182-43376204 GGAGAGGGGGCAGAGGCAGCTGG + Intergenic
1179752143 21:43474679-43474701 AGTGTGGGGGAGGCGGGTGCGGG + Intergenic
1179859420 21:44179287-44179309 AGTGGGCAGGCAGGGGCTGCTGG - Intergenic
1179872525 21:44250521-44250543 ACTGAGGGGGCAGGGGCAGGAGG + Intronic
1179976713 21:44872712-44872734 AGTGAGGGCGCGGGGGCTGGGGG - Intronic
1180666725 22:17519171-17519193 AGTGAGTGGGCTGAGGCTGGTGG + Intronic
1180852800 22:19029867-19029889 GGTGAGCGAGCGGCGGCTGCAGG + Intergenic
1181047760 22:20223674-20223696 AGGGATGGGGAAGAGGCTGCAGG + Intergenic
1181107257 22:20582670-20582692 GGGGAGGGGGCATCGACTGCGGG - Exonic
1181547321 22:23609504-23609526 AGTGAGGGAGCAGCTTCTCCTGG - Intronic
1182097347 22:27634933-27634955 GGTGAGGGTGCAGCGGCAGGGGG - Intergenic
1182119792 22:27779255-27779277 AGTGAGGAGGAAGCGCCTGCCGG - Intronic
1182335530 22:29581034-29581056 TGTGACGGCGCGGCGGCTGCTGG - Exonic
1182470304 22:30544249-30544271 GGAGAGGGGGCCGTGGCTGCTGG - Intronic
1182609869 22:31538370-31538392 AGTCATGGGGCAACGCCTGCAGG + Intronic
1183386187 22:37516143-37516165 AGGGCTGGAGCAGCGGCTGCGGG - Exonic
1183571398 22:38656206-38656228 AGTTTGGGGGCACCGGCTGTCGG - Exonic
1183740719 22:39667077-39667099 ACTGAGGAGTCAGAGGCTGCAGG - Intronic
1183932138 22:41241153-41241175 AGGGAGGGGGCACCAGCAGCTGG + Intergenic
1184371002 22:44082033-44082055 GGTCAGGAGGCAGTGGCTGCTGG + Intronic
1184523152 22:45007571-45007593 AGGGAGGGGGCAGCGGAGGGAGG + Intronic
1184561879 22:45268464-45268486 AGTGAGGGGTGAGCGGGTGGAGG - Intergenic
1184648554 22:45909102-45909124 AGCCAGGTGGCAGAGGCTGCAGG - Intergenic
1184717511 22:46290397-46290419 ACTGAGGGAGCAGCAGCTGAGGG + Intronic
1185011592 22:48317645-48317667 GCAGAGGGGGCAGCGGCTTCTGG - Intergenic
1185042862 22:48514487-48514509 ATTGAGGTGGCCGCGGCTCCTGG + Intronic
1185236143 22:49714419-49714441 AGTGAGGGGGATGCGCCTACAGG + Intergenic
1185294447 22:50046331-50046353 GGAGAGGGAGGAGCGGCTGCAGG + Intronic
949710260 3:6862964-6862986 AGCCATGGGGCAGAGGCTGCTGG - Intronic
950261450 3:11545483-11545505 AGAGAGGAAGGAGCGGCTGCAGG - Intronic
952903588 3:38125754-38125776 AGTGAGCGGGCAGGTGGTGCAGG - Intronic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
953912891 3:46901736-46901758 AGTGAGGGGGCTGCGTCTGGAGG - Intronic
954325130 3:49859355-49859377 AGTAAAGGGGAAGAGGCTGCTGG - Exonic
954377528 3:50203001-50203023 GGTGTGGGGGCAGGAGCTGCAGG + Intergenic
954638694 3:52085381-52085403 AGTGAGGAGGCAGAGGGTGAAGG - Intronic
954671766 3:52294792-52294814 AGAGCTGGGGCAGGGGCTGCAGG + Intergenic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
956290364 3:67654477-67654499 AGCGTGGGGGCAGGAGCTGCGGG - Intronic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
961300068 3:125916510-125916532 AGAGAGGGGGCGGGGCCTGCGGG - Intergenic
962599681 3:136982198-136982220 AGTGAGTGAGCACCAGCTGCTGG - Exonic
962658455 3:137574101-137574123 AGGGAGGTGGCTGCTGCTGCAGG + Intergenic
962876514 3:139539584-139539606 ACTGCCGGGACAGCGGCTGCCGG + Exonic
964423627 3:156530418-156530440 AGTGAGGGGGCAGGGGTTGATGG + Intronic
964570889 3:158106303-158106325 AGAGAAGGGGCGGGGGCTGCCGG + Intronic
966924740 3:184636914-184636936 AGGCAGGAGGCAGGGGCTGCTGG - Intronic
967943334 3:194783172-194783194 AGTGAGTGGGCAGAGGGTGAAGG + Intergenic
968010364 3:195270533-195270555 GGTGAGCGGGCCGCGGCTGGGGG - Exonic
968622152 4:1608632-1608654 AGTGTGTGTGTAGCGGCTGCAGG - Intergenic
968642763 4:1722547-1722569 AGAGAGGGGGCAGCCCCGGCAGG - Intronic
969515077 4:7642842-7642864 GATGAGGGGGCAGAGGCTCCAGG + Intronic
969673069 4:8600433-8600455 AGTGTGGAGCCAGCGGCTGCGGG + Intronic
969858933 4:10020895-10020917 AGTGAGTGGGGAGCGGGTGGAGG - Intronic
971057798 4:22933186-22933208 AAGGAGGAGGCAGCGGCTGTTGG + Intergenic
971509573 4:27407304-27407326 AGAGAGTGGGCAGGGGCTGAGGG - Intergenic
973759084 4:54100621-54100643 AGTGGGGTGGCAGGGGCCGCAGG + Exonic
976161118 4:82200807-82200829 ACTGAGGGGTGAGCGGCGGCGGG + Intergenic
978197913 4:105991899-105991921 AGTGAGGGAGAAGCAGCTGCAGG + Intronic
979547201 4:121951699-121951721 AGTGTGGGGGTGCCGGCTGCCGG + Exonic
982279449 4:153668364-153668386 TGTGAGGAGGCAGAAGCTGCTGG + Intergenic
982559130 4:156907798-156907820 AGTGTGGGGGCATCTGCTTCAGG - Intronic
984844942 4:184100944-184100966 AGGAAGGGGGCTGCAGCTGCTGG + Intronic
984939165 4:184916604-184916626 AGTGATGGGGGCGCTGCTGCAGG + Intergenic
985017405 4:185651007-185651029 AGTGAGGTTGCAGCTGCTGAAGG + Intronic
985287339 4:188349679-188349701 AGAGAAGGGGCAGAGGCTGTTGG - Intergenic
985389304 4:189478554-189478576 AGTGAGGGGGCCTGGGCAGCTGG + Intergenic
985626935 5:993960-993982 TGTGAGGGGGCAGTGCATGCTGG - Intergenic
985751584 5:1681726-1681748 TGTGAAGAGGCAGGGGCTGCTGG + Intergenic
985908980 5:2864230-2864252 AGGGTGGGTGCAGGGGCTGCCGG + Intergenic
987880351 5:23736129-23736151 ACTCAGGAGGCAGCGGTTGCAGG - Intergenic
988891355 5:35620186-35620208 AATGATGGGGCAGCAGCAGCAGG - Intronic
996090242 5:119343839-119343861 ACAGCGGGGGCAGCTGCTGCTGG - Intronic
996821056 5:127628242-127628264 ACTGAGGGGGCAGTGGCAGTGGG - Intergenic
997197089 5:131987507-131987529 AGTGGGGGGTCAGCTGCTACTGG + Intronic
998351881 5:141507455-141507477 AGAGAGGTGGCAGGGACTGCTGG + Intronic
998919278 5:147049917-147049939 GGTGATGGGGCAGCGGGTGAAGG + Intronic
998957589 5:147453520-147453542 AGGGAGGGAGCAGCGGCGCCCGG + Intronic
999314093 5:150573097-150573119 TGCAAGGGGGCAGAGGCTGCCGG + Intergenic
999461082 5:151758242-151758264 AGAGAGGGGGCAGGGGATGGGGG - Intronic
1001247308 5:170114452-170114474 AGTGCGGAGGCAGAGGCTGGAGG - Intergenic
1002107048 5:176884782-176884804 AGGGAGGGGGCAGGGGGAGCAGG + Intronic
1002195308 5:177497807-177497829 CGGGAGGGGGCCGGGGCTGCGGG + Intergenic
1002204505 5:177553778-177553800 GCTGAGGGGGCCGCGGCTGCAGG + Intronic
1002806920 6:586243-586265 AGAGAGGTGGCATCCGCTGCAGG + Intronic
1002817330 6:693090-693112 AGTGAGGTGCCGGCGGCTGGCGG - Exonic
1002826986 6:783094-783116 ACTCAGGGGGCAGAGGTTGCAGG - Intergenic
1004424151 6:15496488-15496510 GGTGGGGGGGCGGCAGCTGCGGG + Exonic
1005967581 6:30738239-30738261 AGTGATGCTGCAGCTGCTGCTGG + Intronic
1006062945 6:31439171-31439193 AGTGAGTGGGCAGTGGGTGGTGG + Intergenic
1006793294 6:36717291-36717313 ACTGTGGGGGCAGCTGCGGCAGG + Exonic
1006855668 6:37131511-37131533 AGCGAGGGGGAAGCCACTGCCGG + Intergenic
1007761096 6:44134230-44134252 AGTGTGGGGGTGGCGGCGGCAGG + Intronic
1016906727 6:149158385-149158407 AGACAGGGGGCAGAGGTTGCAGG + Intergenic
1017235129 6:152111049-152111071 AGTGAGGGTGCCACCGCTGCAGG - Intronic
1017684789 6:156901444-156901466 GGTGCGGGGGCTGCGGCTGCTGG - Exonic
1017717868 6:157224665-157224687 GGTGAGTGGGGAGCGGCTGAGGG + Intergenic
1018856537 6:167679021-167679043 CGTGCAGGGGCAGCTGCTGCTGG - Intergenic
1018872714 6:167795740-167795762 AGTGAGGTGGCACGGGGTGCAGG - Intronic
1019132426 6:169887032-169887054 AAGGAGGGGGCAGAGGCGGCTGG - Intergenic
1019512087 7:1422705-1422727 GGGCAGGGGGCAGCGTCTGCAGG - Intergenic
1019512332 7:1423964-1423986 AGTGAGGGGGAAGAGGCGGCAGG + Intergenic
1019892553 7:3957970-3957992 ATTAAGGGGGAAGCGGCTGAAGG - Intronic
1020039850 7:4993629-4993651 GGAGCGGGGGCAGGGGCTGCTGG + Intronic
1020084358 7:5302667-5302689 AGCGATGGGGCAGCGGGTCCTGG + Intronic
1023940888 7:44767821-44767843 AGGGAGGTGGCAAGGGCTGCCGG - Exonic
1025148098 7:56522577-56522599 ACTCAGGGGGCAGAGGCTGGAGG + Intergenic
1025209934 7:57014532-57014554 AGCGATGGGGCAGCGGGTCCTGG - Intergenic
1025662017 7:63562319-63562341 AGCGATGGGGCAGCGGGTCCTGG + Intergenic
1026224469 7:68428368-68428390 AGTGATGGGGGAGAGGGTGCAGG + Intergenic
1026584068 7:71642037-71642059 AGTGGGGGGACAGCTGATGCTGG - Intronic
1026789811 7:73324360-73324382 AGTGAGGGTGCAGGGGCGGCTGG - Intronic
1029508990 7:100981460-100981482 AGTGAGCAGGCAAGGGCTGCAGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1031998521 7:128248776-128248798 AGGGATGGGGCAGAGGCTGATGG - Intronic
1032063403 7:128744669-128744691 AGTGAGGAAGCAGAGGCAGCAGG + Intronic
1033017406 7:137685696-137685718 TCAGAGGGGGCAGCTGCTGCAGG + Intronic
1035846928 8:2875204-2875226 AGTGATGGGGCAGCCGCTCAGGG + Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1036751330 8:11445300-11445322 GGTGAGGGGGCAGTGGCACCTGG - Intronic
1036768876 8:11565495-11565517 AGAAAGGGGGCAGTCGCTGCAGG + Intergenic
1038251442 8:25908745-25908767 AGTGATGGGGAAGCGGGTGCTGG - Intronic
1038883477 8:31639555-31639577 AGTGATGCTGCGGCGGCTGCTGG - Intronic
1039510227 8:38085936-38085958 AATCAGGGGGCAGTGGCTTCTGG + Intergenic
1042867115 8:73365859-73365881 AGTGCGGAGGCAGTGCCTGCTGG - Intergenic
1043401823 8:79891837-79891859 TGTGAAAGAGCAGCGGCTGCCGG - Intergenic
1045305322 8:100952407-100952429 AGTGGGCCGGCAGAGGCTGCAGG - Intronic
1048646563 8:136427639-136427661 AGTGAGGGTGAAGTGACTGCTGG + Intergenic
1049156934 8:141073033-141073055 AGTGTGGGGCCAGCACCTGCAGG - Intergenic
1049535687 8:143180271-143180293 GGTGATGGGGCAGGGGTTGCGGG - Intergenic
1049551445 8:143261787-143261809 CGGGTGGGGGCAGGGGCTGCTGG - Intronic
1049680734 8:143916884-143916906 CATCACGGGGCAGCGGCTGCTGG - Exonic
1049689027 8:143950728-143950750 AGTGCGGGGGCAAAGGCAGCAGG + Exonic
1049885490 9:23592-23614 AGTGAAGGAGCAGGGGCTCCAGG + Intergenic
1051334661 9:16055018-16055040 TGAGAGGGGGCAGTGGCTGTCGG + Intronic
1051535778 9:18155919-18155941 GGTGAGGGGTCAGAGGATGCTGG + Intergenic
1051621036 9:19049582-19049604 AGGGAGGGGTCGGGGGCTGCCGG - Exonic
1051641809 9:19230700-19230722 ACTGAGGCGGCGGCGGCCGCTGG + Exonic
1052830553 9:33211966-33211988 AGAGAGGGGGCAGCAGCATCAGG - Intergenic
1053000936 9:34577119-34577141 AGTGATGGGGGCGGGGCTGCAGG - Intronic
1053474907 9:38375743-38375765 TGTGAGGGGTCAGCAGCTGTGGG - Intergenic
1056773359 9:89495538-89495560 AGGGAGGTGGCAGAGGCAGCTGG - Intronic
1056799518 9:89681437-89681459 CGAGGGGGGGCGGCGGCTGCTGG - Intergenic
1056950790 9:91039376-91039398 AGTGCGGGGGCAGGGGCCACAGG + Intergenic
1057411406 9:94819374-94819396 AGTGTGTGGCCAGCAGCTGCGGG + Intronic
1058214307 9:102214792-102214814 AGTGATGGGCCAGCAACTGCAGG - Intergenic
1059139733 9:111841623-111841645 TGAGAGGGGGCAGAAGCTGCAGG - Intergenic
1059989745 9:119853903-119853925 TGGGAGGGGGCAGTGGCTGAAGG + Intergenic
1060404126 9:123364684-123364706 ACTTAGGGGGCAGGGCCTGCTGG + Intronic
1061296860 9:129681642-129681664 AGAGAGGGGGCACCGGATGGAGG - Intronic
1061351900 9:130072046-130072068 ACCGAGGAGGCAGAGGCTGCAGG - Intronic
1061653427 9:132069245-132069267 AGGGAGGCTGCAGAGGCTGCTGG - Intronic
1062084167 9:134640237-134640259 AGTAAAGGGCCAGTGGCTGCAGG + Intergenic
1062177919 9:135174598-135174620 AGTCAGGGGCCAGCGGCAGAGGG - Intergenic
1062433966 9:136538272-136538294 GGGGAAGGGGCAGTGGCTGCAGG - Intronic
1062448080 9:136604104-136604126 AGCGAGGTGGCAGCTCCTGCCGG - Intergenic
1185559132 X:1045232-1045254 AGTGAGGGGGCAGGGCGTGGTGG - Intergenic
1186801094 X:13092937-13092959 AGTGAGGGGGCAGGGGTGGAGGG + Intergenic
1187269804 X:17769380-17769402 AGTGGAGGTGCAGCAGCTGCAGG - Intergenic
1190598522 X:52068209-52068231 AGGGAGGGTGAAGCAGCTGCAGG + Exonic
1190610302 X:52185864-52185886 AGGGAGGGTGAAGCAGCTGCAGG - Exonic
1190985050 X:55492350-55492372 AGTGAGGGGACAGGGGCAGGAGG - Intergenic
1191715265 X:64189983-64190005 AGTGAGTGGGCTGAGGCTGGGGG + Exonic
1192201765 X:69070906-69070928 AATGAGGGGGCAGAGGGTGATGG + Intergenic
1192769992 X:74178807-74178829 AGCCAGAGGGCAGCGGTTGCAGG - Intergenic
1199991576 X:152990316-152990338 AGGGAGGGGCCACAGGCTGCAGG - Exonic
1200292497 X:154886372-154886394 AGCATGGCGGCAGCGGCTGCAGG + Exonic
1200339341 X:155382112-155382134 AGCATGGCGGCAGCGGCTGCAGG + Exonic
1200347129 X:155458581-155458603 AGCATGGCGGCAGCGGCTGCAGG - Exonic
1201866591 Y:18662068-18662090 AGTGTGGGGGAAGGGGCTTCAGG + Intergenic