ID: 1122888795

View in Genome Browser
Species Human (GRCh38)
Location 14:104723396-104723418
Sequence TAGGCCCCAGAGGGAGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888795_1122888800 -6 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888800 14:104723413-104723435 GGCCTAGTCCCTCCACAGGCTGG No data
1122888795_1122888804 0 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888804 14:104723419-104723441 GTCCCTCCACAGGCTGGGCCGGG No data
1122888795_1122888813 24 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888813 14:104723443-104723465 AGGTCTGGTGTGGGACCTCTTGG No data
1122888795_1122888811 15 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888811 14:104723434-104723456 GGGCCGGGAAGGTCTGGTGTGGG No data
1122888795_1122888803 -1 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888803 14:104723418-104723440 AGTCCCTCCACAGGCTGGGCCGG No data
1122888795_1122888801 -5 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888801 14:104723414-104723436 GCCTAGTCCCTCCACAGGCTGGG No data
1122888795_1122888799 -10 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888799 14:104723409-104723431 CTGGGGCCTAGTCCCTCCACAGG No data
1122888795_1122888814 25 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888814 14:104723444-104723466 GGTCTGGTGTGGGACCTCTTGGG No data
1122888795_1122888809 9 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888809 14:104723428-104723450 CAGGCTGGGCCGGGAAGGTCTGG No data
1122888795_1122888807 4 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888807 14:104723423-104723445 CTCCACAGGCTGGGCCGGGAAGG No data
1122888795_1122888810 14 Left 1122888795 14:104723396-104723418 CCATCGCCTCCCTCTGGGGCCTA No data
Right 1122888810 14:104723433-104723455 TGGGCCGGGAAGGTCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888795 Original CRISPR TAGGCCCCAGAGGGAGGCGA TGG (reversed) Intergenic