ID: 1122888796

View in Genome Browser
Species Human (GRCh38)
Location 14:104723402-104723424
Sequence AGGGACTAGGCCCCAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888796_1122888811 9 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888811 14:104723434-104723456 GGGCCGGGAAGGTCTGGTGTGGG No data
1122888796_1122888804 -6 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888804 14:104723419-104723441 GTCCCTCCACAGGCTGGGCCGGG No data
1122888796_1122888815 26 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888815 14:104723451-104723473 TGTGGGACCTCTTGGGAACCTGG No data
1122888796_1122888814 19 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888814 14:104723444-104723466 GGTCTGGTGTGGGACCTCTTGGG No data
1122888796_1122888809 3 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888809 14:104723428-104723450 CAGGCTGGGCCGGGAAGGTCTGG No data
1122888796_1122888803 -7 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888803 14:104723418-104723440 AGTCCCTCCACAGGCTGGGCCGG No data
1122888796_1122888816 27 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888796_1122888810 8 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888810 14:104723433-104723455 TGGGCCGGGAAGGTCTGGTGTGG No data
1122888796_1122888807 -2 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888807 14:104723423-104723445 CTCCACAGGCTGGGCCGGGAAGG No data
1122888796_1122888813 18 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888813 14:104723443-104723465 AGGTCTGGTGTGGGACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888796 Original CRISPR AGGGACTAGGCCCCAGAGGG AGG (reversed) Intergenic