ID: 1122888802

View in Genome Browser
Species Human (GRCh38)
Location 14:104723415-104723437
Sequence GCCCAGCCTGTGGAGGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888802_1122888819 25 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG No data
1122888802_1122888809 -10 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888809 14:104723428-104723450 CAGGCTGGGCCGGGAAGGTCTGG No data
1122888802_1122888816 14 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888802_1122888810 -5 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888810 14:104723433-104723455 TGGGCCGGGAAGGTCTGGTGTGG No data
1122888802_1122888813 5 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888813 14:104723443-104723465 AGGTCTGGTGTGGGACCTCTTGG No data
1122888802_1122888818 22 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888802_1122888814 6 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888814 14:104723444-104723466 GGTCTGGTGTGGGACCTCTTGGG No data
1122888802_1122888811 -4 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888811 14:104723434-104723456 GGGCCGGGAAGGTCTGGTGTGGG No data
1122888802_1122888815 13 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888815 14:104723451-104723473 TGTGGGACCTCTTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888802 Original CRISPR GCCCAGCCTGTGGAGGGACT AGG (reversed) Intergenic