ID: 1122888805

View in Genome Browser
Species Human (GRCh38)
Location 14:104723421-104723443
Sequence TTCCCGGCCCAGCCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888805_1122888818 16 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888805_1122888819 19 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG No data
1122888805_1122888814 0 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888814 14:104723444-104723466 GGTCTGGTGTGGGACCTCTTGGG No data
1122888805_1122888811 -10 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888811 14:104723434-104723456 GGGCCGGGAAGGTCTGGTGTGGG No data
1122888805_1122888815 7 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888815 14:104723451-104723473 TGTGGGACCTCTTGGGAACCTGG No data
1122888805_1122888816 8 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888805_1122888813 -1 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA 0: 1
1: 0
2: 2
3: 10
4: 210
Right 1122888813 14:104723443-104723465 AGGTCTGGTGTGGGACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888805 Original CRISPR TTCCCGGCCCAGCCTGTGGA GGG (reversed) Intergenic