ID: 1122888806

View in Genome Browser
Species Human (GRCh38)
Location 14:104723422-104723444
Sequence CTTCCCGGCCCAGCCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888806_1122888819 18 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG No data
1122888806_1122888814 -1 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888814 14:104723444-104723466 GGTCTGGTGTGGGACCTCTTGGG No data
1122888806_1122888816 7 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888806_1122888815 6 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888815 14:104723451-104723473 TGTGGGACCTCTTGGGAACCTGG No data
1122888806_1122888813 -2 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888813 14:104723443-104723465 AGGTCTGGTGTGGGACCTCTTGG No data
1122888806_1122888818 15 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888806 Original CRISPR CTTCCCGGCCCAGCCTGTGG AGG (reversed) Intergenic