ID: 1122888808

View in Genome Browser
Species Human (GRCh38)
Location 14:104723425-104723447
Sequence GACCTTCCCGGCCCAGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888808_1122888818 12 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888808_1122888814 -4 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888814 14:104723444-104723466 GGTCTGGTGTGGGACCTCTTGGG No data
1122888808_1122888826 30 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888826 14:104723478-104723500 CACGGTGGCGTGCATCCCTGGGG No data
1122888808_1122888816 4 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888808_1122888825 29 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888825 14:104723477-104723499 CCACGGTGGCGTGCATCCCTGGG No data
1122888808_1122888823 28 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888823 14:104723476-104723498 CCCACGGTGGCGTGCATCCCTGG No data
1122888808_1122888815 3 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888815 14:104723451-104723473 TGTGGGACCTCTTGGGAACCTGG No data
1122888808_1122888819 15 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG No data
1122888808_1122888813 -5 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888813 14:104723443-104723465 AGGTCTGGTGTGGGACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888808 Original CRISPR GACCTTCCCGGCCCAGCCTG TGG (reversed) Intergenic