ID: 1122888812

View in Genome Browser
Species Human (GRCh38)
Location 14:104723437-104723459
Sequence GGTCCCACACCAGACCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888812_1122888815 -9 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888815 14:104723451-104723473 TGTGGGACCTCTTGGGAACCTGG No data
1122888812_1122888825 17 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888825 14:104723477-104723499 CCACGGTGGCGTGCATCCCTGGG No data
1122888812_1122888819 3 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG No data
1122888812_1122888823 16 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888823 14:104723476-104723498 CCCACGGTGGCGTGCATCCCTGG No data
1122888812_1122888827 19 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888827 14:104723479-104723501 ACGGTGGCGTGCATCCCTGGGGG No data
1122888812_1122888818 0 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888812_1122888826 18 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888826 14:104723478-104723500 CACGGTGGCGTGCATCCCTGGGG No data
1122888812_1122888816 -8 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888812 Original CRISPR GGTCCCACACCAGACCTTCC CGG (reversed) Intergenic