ID: 1122888816

View in Genome Browser
Species Human (GRCh38)
Location 14:104723452-104723474
Sequence GTGGGACCTCTTGGGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888812_1122888816 -8 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888796_1122888816 27 Left 1122888796 14:104723402-104723424 CCTCCCTCTGGGGCCTAGTCCCT No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888808_1122888816 4 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888802_1122888816 14 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888797_1122888816 24 Left 1122888797 14:104723405-104723427 CCCTCTGGGGCCTAGTCCCTCCA No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888798_1122888816 23 Left 1122888798 14:104723406-104723428 CCTCTGGGGCCTAGTCCCTCCAC No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888806_1122888816 7 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data
1122888805_1122888816 8 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA No data
Right 1122888816 14:104723452-104723474 GTGGGACCTCTTGGGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888816 Original CRISPR GTGGGACCTCTTGGGAACCT GGG Intergenic