ID: 1122888817

View in Genome Browser
Species Human (GRCh38)
Location 14:104723458-104723480
Sequence GTGGGGCCCAGGTTCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888817_1122888823 -5 Left 1122888817 14:104723458-104723480 CCTCTTGGGAACCTGGGCCCCAC No data
Right 1122888823 14:104723476-104723498 CCCACGGTGGCGTGCATCCCTGG No data
1122888817_1122888830 18 Left 1122888817 14:104723458-104723480 CCTCTTGGGAACCTGGGCCCCAC No data
Right 1122888830 14:104723499-104723521 GGGTTGCTCCCATGCCAGCCAGG No data
1122888817_1122888825 -4 Left 1122888817 14:104723458-104723480 CCTCTTGGGAACCTGGGCCCCAC No data
Right 1122888825 14:104723477-104723499 CCACGGTGGCGTGCATCCCTGGG No data
1122888817_1122888826 -3 Left 1122888817 14:104723458-104723480 CCTCTTGGGAACCTGGGCCCCAC No data
Right 1122888826 14:104723478-104723500 CACGGTGGCGTGCATCCCTGGGG No data
1122888817_1122888827 -2 Left 1122888817 14:104723458-104723480 CCTCTTGGGAACCTGGGCCCCAC No data
Right 1122888827 14:104723479-104723501 ACGGTGGCGTGCATCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888817 Original CRISPR GTGGGGCCCAGGTTCCCAAG AGG (reversed) Intergenic