ID: 1122888818

View in Genome Browser
Species Human (GRCh38)
Location 14:104723460-104723482
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888806_1122888818 15 Left 1122888806 14:104723422-104723444 CCTCCACAGGCTGGGCCGGGAAG No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888802_1122888818 22 Left 1122888802 14:104723415-104723437 CCTAGTCCCTCCACAGGCTGGGC No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888812_1122888818 0 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888805_1122888818 16 Left 1122888805 14:104723421-104723443 CCCTCCACAGGCTGGGCCGGGAA No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data
1122888808_1122888818 12 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888818 14:104723460-104723482 TCTTGGGAACCTGGGCCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888818 Original CRISPR TCTTGGGAACCTGGGCCCCA CGG Intergenic