ID: 1122888823

View in Genome Browser
Species Human (GRCh38)
Location 14:104723476-104723498
Sequence CCCACGGTGGCGTGCATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122888808_1122888823 28 Left 1122888808 14:104723425-104723447 CCACAGGCTGGGCCGGGAAGGTC No data
Right 1122888823 14:104723476-104723498 CCCACGGTGGCGTGCATCCCTGG No data
1122888817_1122888823 -5 Left 1122888817 14:104723458-104723480 CCTCTTGGGAACCTGGGCCCCAC No data
Right 1122888823 14:104723476-104723498 CCCACGGTGGCGTGCATCCCTGG No data
1122888812_1122888823 16 Left 1122888812 14:104723437-104723459 CCGGGAAGGTCTGGTGTGGGACC No data
Right 1122888823 14:104723476-104723498 CCCACGGTGGCGTGCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122888823 Original CRISPR CCCACGGTGGCGTGCATCCC TGG Intergenic