ID: 1122890162

View in Genome Browser
Species Human (GRCh38)
Location 14:104728536-104728558
Sequence AGGGAGTGAAGCAGTGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122890153_1122890162 30 Left 1122890153 14:104728483-104728505 CCTTTGGGTTGAAGGAATGAATG 0: 1
1: 0
2: 3
3: 23
4: 208
Right 1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG 0: 1
1: 0
2: 0
3: 26
4: 349
1122890158_1122890162 -4 Left 1122890158 14:104728517-104728539 CCTGCAAGCAGAGCCCAGAAGGG 0: 1
1: 0
2: 2
3: 32
4: 274
Right 1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG 0: 1
1: 0
2: 0
3: 26
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122890162 Original CRISPR AGGGAGTGAAGCAGTGTAAG TGG Intronic
900124159 1:1062165-1062187 AGGGAGGGAAGGGGTGTGAGAGG - Intergenic
900802675 1:4747122-4747144 AGGGAGAGAAGGAGAGGAAGAGG + Intronic
905111721 1:35599807-35599829 AGGGGGTGAACCAGAGTAATGGG + Intronic
906141179 1:43534495-43534517 TGGGAGTGAAGGAGAGGAAGAGG + Intronic
906243205 1:44255235-44255257 AGGGAGTGAAGGAGTGAAGGAGG - Intronic
906812809 1:48846532-48846554 AGGCAATGAAGCAATATAAGAGG - Intronic
907266544 1:53265046-53265068 AGGGAATGAAGCAGGGAAACTGG + Intronic
908718588 1:67097802-67097824 AAGGATTGTAGCAGTGTAAGTGG + Intronic
909432766 1:75608763-75608785 AGGACATGAAGCAGTGGAAGGGG - Intronic
909977422 1:82061544-82061566 AGGGAGTCAATCACTGGAAGTGG - Intergenic
910274477 1:85434092-85434114 GGTGAGGGAAACAGTGTAAGTGG - Intronic
912728775 1:112082736-112082758 AGGGAGTGAGGAAGTGAGAGAGG + Intergenic
914708098 1:150188024-150188046 AGGAAGTGAAGAGGTCTAAGAGG - Intergenic
915166575 1:153951401-153951423 AGGGGTAGAAGCAGGGTAAGAGG + Exonic
915900677 1:159844564-159844586 AGGGAAAAAAGCAGTGTAGGAGG + Intronic
916419854 1:164626789-164626811 AGGGAGTGAGGCCCTGAAAGTGG - Intronic
917990551 1:180373008-180373030 AGGGAGAGCAGTAGGGTAAGTGG - Intronic
918080728 1:181206100-181206122 TGGGAGTGAAGAAGTGAAAAAGG + Intergenic
918194226 1:182206832-182206854 GGGGAGTGAAGCACTATATGGGG - Intergenic
920258444 1:204672680-204672702 AGGGAGGGAAGGAGAGCAAGAGG - Intronic
920736948 1:208541426-208541448 GAGGAGTGAATCAGTGTAGGAGG + Intergenic
920997495 1:211009522-211009544 AAGGAGGGAAGCAGAGTACGTGG + Intronic
921981807 1:221266816-221266838 CTGGATAGAAGCAGTGTAAGCGG + Intergenic
922931949 1:229396901-229396923 AAGGAGTGGGGCAGGGTAAGTGG - Intergenic
923037056 1:230291856-230291878 AGGGAGGGAAGCGGTGTGGGGGG + Intergenic
924572409 1:245249032-245249054 GGCAAGTGAAGCAGTGTTAGAGG + Intronic
1063486914 10:6428748-6428770 AGGGAGTGAGGGGGTGTGAGCGG + Intronic
1066045678 10:31593745-31593767 AGGGAGGGAAGGAGAGGAAGAGG + Intergenic
1068001989 10:51346499-51346521 AGGAAATGCAGCAATGTAAGTGG + Intronic
1068120590 10:52779338-52779360 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068120598 10:52779358-52779380 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068120606 10:52779378-52779400 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1068120614 10:52779398-52779420 AGGGAGGGAAGGAGGGGAAGAGG - Intergenic
1069409233 10:68135299-68135321 TGGGAGGGTAGGAGTGTAAGTGG - Intronic
1069755105 10:70769735-70769757 AGGGAGAGAAGCAGGGGAAAGGG + Intergenic
1070523166 10:77272088-77272110 AGGAAATGAAACAGTGTGAGGGG - Intronic
1071220741 10:83462280-83462302 AGGCAGTGAAGAAGTGGATGAGG - Intergenic
1071982875 10:91021612-91021634 AGCTAGGGAAACAGTGTAAGAGG + Intergenic
1072004532 10:91231581-91231603 AGTGAGTGAAGGAGTGTTAGAGG + Intronic
1072716057 10:97753307-97753329 AGGGAGTGAAGGTGTGTCCGCGG + Intronic
1072784409 10:98269879-98269901 AGGCTGGGAAGCAGTGGAAGTGG + Intergenic
1073558415 10:104476049-104476071 AGGGAATGATGCAGTTAAAGGGG + Intergenic
1073592142 10:104767659-104767681 AGGGAGTGGAGAAGGGGAAGGGG - Intronic
1074336144 10:112577828-112577850 AGGCAGTGAAGAATTGCAAGAGG + Intronic
1074588963 10:114794232-114794254 AGAAAATGAAGCAGGGTAAGAGG - Intergenic
1074953790 10:118367534-118367556 AAGGAGGGAAGCAAGGTAAGTGG + Intergenic
1075247529 10:120836470-120836492 AGAGAGTGGAGCAGGGTGAGGGG + Intergenic
1075340615 10:121644537-121644559 AGGGACTAAAGCAGAGTAAAGGG + Intergenic
1077416595 11:2426937-2426959 AGGGAGTGGGGCAGTGGGAGGGG - Intergenic
1079024336 11:16934144-16934166 AGGGAGTGTTGAAGTGGAAGGGG - Intronic
1079323807 11:19474586-19474608 ATGGAGTGAAGGAGTGGATGAGG + Intronic
1079412888 11:20206701-20206723 AGGGAGAGAAGAAATGTTAGAGG + Intergenic
1081083029 11:38767123-38767145 AGGAAGAGAAGTAGTGAAAGTGG - Intergenic
1081662990 11:44899816-44899838 AGGGAGAGTAGCAGTGTGGGTGG - Intronic
1081704288 11:45171752-45171774 AGGCAATAAAGCAGTGTAAGAGG + Intronic
1082934375 11:58641068-58641090 AGAGAGTGAGGCAGGGTAGGAGG - Intronic
1083808768 11:65090613-65090635 AGGGATTGAAGCAGGAGAAGAGG + Intronic
1084708862 11:70831549-70831571 AGGGGGTGGTGCAGTGTATGGGG - Intronic
1084717460 11:70883000-70883022 AGAGAGAGAAGCAGTGTTATGGG + Intronic
1086817706 11:91393753-91393775 AGAGAGTGAAAAAGTGGAAGGGG + Intergenic
1087287355 11:96279327-96279349 AAGGAGAGAAGCAATGTTAGGGG + Intronic
1088455634 11:110030363-110030385 AGGGTGTGAGGCAGTGAATGGGG - Intergenic
1088854558 11:113735852-113735874 AGGGAGTGCAGTAGTTTTAGAGG - Intronic
1089029380 11:115308759-115308781 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1089184411 11:116605239-116605261 AGGGGGTGTACCAGAGTAAGAGG - Intergenic
1092639880 12:10494083-10494105 AGGGAGTGAACCAGTTGAACAGG + Intergenic
1092902968 12:13076896-13076918 AGGGAGTGCAGGAGTGGGAGAGG + Intronic
1093182553 12:15983516-15983538 AGGGGGAGAAGCAGTGTCAGGGG - Intronic
1093838601 12:23868044-23868066 AGGGAGAGAAGGAGGGAAAGAGG - Intronic
1094277035 12:28689221-28689243 AGGGAGTGGAGGAGAGCAAGCGG + Intergenic
1095650591 12:44604245-44604267 AGGGAGGGAAGCAAGGAAAGAGG + Intronic
1095700910 12:45190043-45190065 AGGGAGGGAAGAAGGGAAAGAGG - Intergenic
1098137332 12:67416507-67416529 AGGGAGAGAAGCAGGGAAGGAGG - Intergenic
1098408633 12:70154241-70154263 AGGAACTGACTCAGTGTAAGAGG - Intergenic
1099403008 12:82223106-82223128 ATGGGGTGAAGAATTGTAAGAGG - Intergenic
1099474118 12:83087060-83087082 AAGCAGTGGAGCAGTTTAAGAGG - Intronic
1099606280 12:84805745-84805767 AGGGAGTGAAGGAGTGCTGGAGG - Intergenic
1100039250 12:90293010-90293032 AAAGAATGAAGAAGTGTAAGTGG + Intergenic
1101540592 12:105661313-105661335 TGGGAATGAAGCAGTGGAAAGGG - Intergenic
1102591166 12:113957886-113957908 AGGGAGTGAGGCCGAGGAAGAGG - Exonic
1103118347 12:118357684-118357706 TGGGGGTGAAGCAGAGGAAGTGG - Intronic
1103746358 12:123127241-123127263 ATGGAGGGCAGCGGTGTAAGTGG - Intronic
1105259127 13:18765966-18765988 AGGGAGTGGAGCTGTGTTGGGGG - Intergenic
1105276140 13:18928745-18928767 AGAGAGAGAAGCAGTCAAAGAGG - Intergenic
1105595027 13:21828895-21828917 ATGGATTGAAGCACTGTATGTGG - Intergenic
1105901632 13:24759717-24759739 AGGGAGTGAAGGAATGAGAGAGG + Intergenic
1106021238 13:25917595-25917617 AGTGAGTGACACAGTGTAATGGG - Intronic
1107418866 13:40226901-40226923 ATCGAGTGAAGCAGTGGGAGTGG - Intergenic
1108048382 13:46404857-46404879 AGGGAGGGAAGGAGTGAAAGAGG + Intronic
1109370733 13:61416289-61416311 AGGGAGAGAGGCAGGGAAAGAGG - Intronic
1109727681 13:66365138-66365160 AGGTACTGAACAAGTGTAAGAGG - Intronic
1110639024 13:77800286-77800308 AGGGAGTTTAGCAGTGTGGGTGG - Intergenic
1112109994 13:96285914-96285936 AGGGAGGGAAGGAGGGAAAGTGG - Intronic
1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG + Intronic
1112620551 13:101050013-101050035 AGGGAGTGAAGAGGTGTCAATGG + Intergenic
1113518822 13:110923740-110923762 AGGTAGAGAACCACTGTAAGTGG - Intergenic
1114535491 14:23419652-23419674 GGGGAATGAAGGGGTGTAAGAGG + Intronic
1115302905 14:31904248-31904270 AGGGAGTGGAGTTGTGAAAGAGG + Intergenic
1115953134 14:38744389-38744411 AGGGAGTGAGTAAGTGAAAGGGG + Intergenic
1116520974 14:45846641-45846663 AGCCACTGAAGCACTGTAAGGGG - Intergenic
1116974120 14:51096252-51096274 AGGGAGGGAAGAAGGGAAAGAGG + Intergenic
1117068355 14:52033188-52033210 AGAGAGTCAGGCAGTTTAAGAGG - Intronic
1117573950 14:57078894-57078916 CAGGAGTGATGAAGTGTAAGGGG - Intergenic
1118166817 14:63344818-63344840 AGGGAATAAAGCAGGGTAAGGGG - Intergenic
1118886086 14:69867069-69867091 AGGGAGTGCGGAAGTGTAATAGG + Intronic
1119762038 14:77158397-77158419 AGGGAGTGAAGGAGTGAGAGAGG + Intronic
1120057515 14:79942249-79942271 AGGGAGTGAAGGAGTTTGAGTGG + Intergenic
1120102497 14:80461440-80461462 AAGGTATGAGGCAGTGTAAGAGG - Intergenic
1120168083 14:81221119-81221141 GGGGAGTGAAGTAGTGAAATCGG + Intronic
1120318847 14:82932904-82932926 AGAGAGAGAAGCTATGTAAGGGG - Intergenic
1120433981 14:84456701-84456723 AGGGAGTGAGGGAGGGAAAGTGG + Intergenic
1121172968 14:91869831-91869853 AGTGAGAGAAGGAGTGGAAGAGG + Intronic
1121733541 14:96202766-96202788 AGGGAGGGAGGCAGTGAGAGAGG + Intergenic
1122624649 14:103078184-103078206 AAGGAGGGAAGCAGAGGAAGGGG + Intergenic
1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG + Intronic
1124172409 15:27387929-27387951 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1124510176 15:30317542-30317564 GTGGAGGGAAGCAGTGTAGGAGG + Intergenic
1124732713 15:32213011-32213033 GTGGAGGGAAGCAGTGTAGGAGG - Intergenic
1124788994 15:32708993-32709015 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1125073989 15:35591233-35591255 TGGGAGTGTATCAGGGTAAGTGG + Intergenic
1125736969 15:41933696-41933718 AGGGATTGAGGCTGTGTAACAGG + Intronic
1125886673 15:43234695-43234717 AGGGGGTGAAGCCCTGTGAGAGG - Intronic
1126052336 15:44697342-44697364 ATCAAGTGAAGCAGTGGAAGTGG + Intronic
1127086128 15:55426119-55426141 AGGAACTGACTCAGTGTAAGAGG - Intronic
1127301767 15:57662046-57662068 AGCGAGTGAAGATGTGTTAGAGG + Intronic
1128211141 15:65903375-65903397 AGGGTGTTGAGCAGTGTAAGTGG + Intronic
1128494002 15:68180747-68180769 AGGGAATGAAGCAATCTGAGTGG - Intronic
1129355394 15:74987485-74987507 AGGAAGAGAAACAGTGGAAGTGG + Intronic
1130303665 15:82699091-82699113 AGTGAGTGCAGCAGCGTAAGGGG - Intronic
1130345805 15:83043587-83043609 AAGGAGGGTAGCAGTGGAAGTGG + Intronic
1130445347 15:83995891-83995913 AGGGCTTACAGCAGTGTAAGAGG + Intronic
1130711346 15:86284669-86284691 AGAGAGTGCAGCAGTTTAGGGGG + Intronic
1131202026 15:90406840-90406862 AGGGAGAGAAGTAGCGTTAGTGG + Intronic
1131726854 15:95235654-95235676 AGGGAGTGAAAGAGTGGAGGGGG + Intergenic
1132169929 15:99640508-99640530 AGGGAGTGAAGGAGGGAGAGAGG - Intronic
1132462972 16:64502-64524 AGGGAGTGGAGCAGGGTAGTGGG + Intronic
1132719165 16:1307493-1307515 AGGGAGTGAATGAGTGAAGGAGG + Intergenic
1134259967 16:12643242-12643264 AGCGAGTGAAGCACTGTATGGGG + Intergenic
1134286784 16:12868630-12868652 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1136461372 16:30412448-30412470 AGGGAGACAAGCTGTGTAAGTGG + Intronic
1136597603 16:31262302-31262324 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1136989823 16:35145278-35145300 ATGGAGGGAAGCAGCGGAAGAGG + Intergenic
1137303147 16:47173202-47173224 AGGGAATAAAGCAGAGTAAAAGG - Intronic
1137834275 16:51575597-51575619 AGGACCAGAAGCAGTGTAAGAGG + Intergenic
1138196826 16:55058191-55058213 AGGGAGTGGAGCCCAGTAAGTGG - Intergenic
1138913213 16:61428520-61428542 AGGGAGGGAAGCAGGGAAGGAGG - Intergenic
1139678013 16:68538908-68538930 AGGGAGTGAGACAGCGTCAGAGG - Intronic
1141895888 16:86958632-86958654 AGAGAATGAAGCTGTGTTAGTGG - Intergenic
1142816220 17:2427999-2428021 AGGGAGGGAGGAAGTGGAAGAGG + Intronic
1143075776 17:4341913-4341935 AGCTAGTGAAGGAGTGTGAGCGG - Intronic
1143374487 17:6459172-6459194 AGGGAGAGGAGCAGAGAAAGTGG - Intronic
1144224507 17:13131842-13131864 AGGGGCTGAAGTACTGTAAGTGG - Intergenic
1144643779 17:16954712-16954734 AAGGGGTGAAGCTCTGTAAGAGG + Intronic
1144719735 17:17460504-17460526 GTCGAGTGAAGCAGTGGAAGTGG - Intergenic
1146510080 17:33439397-33439419 ATGGAGTGAAACAGTGTAGGGGG + Intronic
1146648121 17:34589052-34589074 AGGCAGGGAAGCAGGGTGAGGGG + Intronic
1146698665 17:34933458-34933480 GTGAAGTGAAGCAGTGAAAGGGG - Intronic
1147167700 17:38602191-38602213 AGGGAGGGAGGCAGTGAAGGAGG - Intronic
1147487153 17:40827496-40827518 GGGTAGTGTAGCAGGGTAAGTGG + Intronic
1148634933 17:49141830-49141852 AGGGAGGGAAGCAGGGACAGAGG - Intronic
1151445502 17:74160942-74160964 AGGGAGTGAAGCAGGGAAGGAGG - Intergenic
1151582041 17:74985508-74985530 AGGGAGGGAAGCAGGGTTGGTGG - Intergenic
1152123707 17:78433966-78433988 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1153260881 18:3223894-3223916 AGGGAGGGAAGCAGAGCCAGCGG + Intergenic
1153602268 18:6792600-6792622 ATGGAGTGATACAGTGCAAGGGG + Intronic
1154995297 18:21635031-21635053 AGGGAGTGAAGGAGGGCAACTGG - Intergenic
1155076658 18:22363201-22363223 AGGGAGAGATGCAATGTCAGGGG - Intergenic
1159774442 18:72586463-72586485 AGAGAGTGAAACAGTGACAGTGG + Intronic
1161456672 19:4373111-4373133 AGGGAGAGGAGCAGTGGGAGGGG + Intronic
1163433688 19:17282806-17282828 AGGGAGGGAAGGAAGGTAAGAGG + Intronic
1164611964 19:29638459-29638481 AGGGAATGCAGGAGGGTAAGGGG + Intergenic
1165097410 19:33417186-33417208 GGTTAGTGAGGCAGTGTAAGGGG + Intronic
1166367714 19:42285731-42285753 AGGGAGCCAGGCAGTGTGAGGGG + Intronic
1167447176 19:49544442-49544464 AGGGAATGAGCCAGTGGAAGAGG + Intronic
1167590437 19:50401878-50401900 AGGGAGCGAAGCCGTGGATGTGG - Exonic
1167862251 19:52294661-52294683 AGGGAGTGCAGAGGTGTAAAAGG + Exonic
1168320515 19:55506827-55506849 AGGGAGCAAAGCAGGGGAAGGGG + Intronic
1168432541 19:56292883-56292905 AAGGAGTGAAGCACTGTCACAGG - Intronic
1168462098 19:56567790-56567812 AATGAGTGAAGCACTTTAAGTGG + Exonic
926460279 2:13121280-13121302 CGGAAATGAAGCAGTCTAAGAGG - Intergenic
926518612 2:13881900-13881922 AGCTAGTAAAGCAGAGTAAGGGG - Intergenic
926695144 2:15765833-15765855 AGGTCGTGAGGCAGTGTGAGAGG - Intergenic
927086412 2:19677611-19677633 AGGCAGTGACCCAGTGTAAGTGG + Intergenic
927746368 2:25625527-25625549 AGTGAGTTAAGAAGAGTAAGGGG - Intronic
928697659 2:33865905-33865927 AAAGTGTGAAGCAGGGTAAGAGG + Intergenic
929591760 2:43152539-43152561 AGAGAGTGAGGGAGTGTCAGAGG + Intergenic
931179079 2:59881908-59881930 AGGGAGAGAATAAGTGTATGGGG - Intergenic
934540264 2:95167917-95167939 AGGGACTGGAGAAGAGTAAGTGG + Intronic
937766669 2:125669230-125669252 CTGGAGTGAAGCAGGGTAATGGG - Intergenic
939684480 2:145181701-145181723 ATGGAATGAAGAAGAGTAAGTGG - Intergenic
940603482 2:155890351-155890373 AGGGAGTAAATATGTGTAAGTGG - Intergenic
942081409 2:172402715-172402737 AGGGACTGCAGCAGAGTAAGAGG - Intergenic
942586647 2:177486846-177486868 AGGCAGTGAAGTATTGAAAGAGG - Intronic
943910685 2:193562957-193562979 AGGGAGTGAGGAAGTGAGAGAGG + Intergenic
944351599 2:198734110-198734132 AGGGAGTAAAGAATTTTAAGAGG + Intergenic
944775952 2:202964737-202964759 AGGGAATGAGGAAGTGTAAGGGG - Intronic
944822119 2:203441318-203441340 AGGCTGTGAAGCAGTGTAGGGGG + Exonic
945318765 2:208397511-208397533 AGGGAGTGGAGAATTGTAATAGG + Intronic
945721486 2:213422648-213422670 TGGGAGGGAAGGAGAGTAAGGGG - Intronic
945728577 2:213504259-213504281 AAGGAATGAAGAAGTGAAAGTGG + Intronic
946014443 2:216592735-216592757 AGGGAGGGAAGCAGGTAAAGAGG - Intergenic
946309798 2:218877083-218877105 AGGGAGGGAAGCTGGGGAAGTGG + Intergenic
947334173 2:229064198-229064220 AGGCAGCGAAGCAAGGTAAGAGG + Intronic
948294062 2:236847914-236847936 AGGAAGAGAAGAAGTGTAGGAGG + Intergenic
948364879 2:237448383-237448405 AGGGATTGAAGCTGAGTGAGGGG + Intergenic
1169287677 20:4323121-4323143 AGGGAGAGAAGCAATCTAAAGGG - Intergenic
1169673575 20:8131467-8131489 AGGGAGGGAAGAAGGGAAAGAGG - Intergenic
1169867412 20:10217225-10217247 AGGGAGGGAAGCGGGGTAGGGGG - Intergenic
1170033955 20:11970469-11970491 GGGCAGTGAAGCAATGAAAGAGG + Intergenic
1170309359 20:14975557-14975579 GGGGAGGAAAGCAGTGAAAGGGG + Intronic
1170781608 20:19430464-19430486 AGGGAGGGAAGGAGAGCAAGGGG + Intronic
1171041244 20:21765709-21765731 AGGTAGTGAAGGAGGGTGAGAGG + Intergenic
1171197048 20:23207929-23207951 AGGCAGTGACCCAGTGGAAGAGG + Intergenic
1171905820 20:30899263-30899285 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1172227868 20:33317217-33317239 AGGGAAGGAGGCAGTGGAAGAGG - Intergenic
1173075814 20:39818246-39818268 AGGGGGTTAAGCAGAGTGAGAGG - Intergenic
1173268199 20:41506244-41506266 AGCGTTTTAAGCAGTGTAAGCGG - Intronic
1173541643 20:43857175-43857197 AGGGAGGGAAGAGGAGTAAGAGG + Intergenic
1173856927 20:46256267-46256289 AGAGAGCAAAGCAGAGTAAGGGG + Intronic
1174066955 20:47872656-47872678 AGGGAGTTGAGGAGTGTCAGTGG + Intergenic
1174157263 20:48523760-48523782 AGGGAGTTGAGGAGTGTCAGTGG - Intergenic
1174367346 20:50064583-50064605 AGGGAGAGAGGCAGGGTGAGAGG + Intergenic
1175420457 20:58829119-58829141 AGGTAGAGAAGCAGGGAAAGAGG - Intergenic
1175602639 20:60287468-60287490 AGAGAGTGAAGAAGTGGAGGTGG + Intergenic
1178183597 21:30193340-30193362 AGGTAGTGAGCCATTGTAAGGGG - Intergenic
1178712856 21:34934787-34934809 AGGGTGTGAATCAGGGAAAGAGG + Intronic
1179087665 21:38234058-38234080 AGGGAGTGGAGCTGTGTTGGAGG - Intronic
1181392618 22:22594679-22594701 AGGGAGTGATGCAGGGTGTGGGG + Intergenic
1181404523 22:22673263-22673285 AGGGAGTGATGCAGAGTGTGGGG + Intergenic
1181425902 22:22838513-22838535 AGGGAGTGACGCAGTGTGTGGGG + Intronic
1181429942 22:22873122-22873144 AGGGAGTGATGCAGGGTGTGGGG + Intronic
1182263093 22:29089968-29089990 AAGGAATGAAGCAGAGTAAAGGG - Intronic
1182774245 22:32819151-32819173 AGGGAGTGAGGTAGTGAAAGAGG + Intronic
1182861511 22:33563388-33563410 TGGGTGTGAAGCAGTGTGACGGG - Intronic
1183301807 22:37062442-37062464 AGGGGGTGATGCAGGGCAAGGGG - Intronic
1184422825 22:44391734-44391756 AGGGAGTGGAGGAGAGGAAGGGG - Intergenic
1184707660 22:46225308-46225330 AGGGATGGAAGCAGAGTCAGGGG + Intronic
1185246871 22:49777313-49777335 AGGGAGTGAACCTGTGGCAGGGG + Intronic
953737496 3:45508879-45508901 AGGGAGGGAGGCAGGGAAAGAGG - Intronic
954196023 3:48997786-48997808 CGGGGCTGAGGCAGTGTAAGAGG - Intronic
954538559 3:51379245-51379267 AGGGATTGAAGCTGCTTAAGAGG - Intronic
955231312 3:57101299-57101321 TGGGAGTGCTGCAGTGTATGTGG + Exonic
955700811 3:61680295-61680317 AGTGAGGGAAGCAGGGTAGGTGG + Intronic
956210401 3:66795952-66795974 AGGGTGAGAAGCAGTGAGAGAGG + Intergenic
960517186 3:118615392-118615414 AGGCAGAGAAGCAGTGTGGGAGG - Intergenic
960521612 3:118661807-118661829 AGGGGGTAAAGCAGTGTGGGAGG + Intergenic
960535595 3:118811507-118811529 TTGGAGTAAAGCAATGTAAGCGG + Intergenic
960629085 3:119710802-119710824 ACGGAGTGAACCAAGGTAAGAGG + Intronic
961499955 3:127325282-127325304 GGGGAGTGCACCAGGGTAAGAGG + Intergenic
962379010 3:134881736-134881758 AGGGACTGATGTAGTCTAAGAGG - Intronic
962916499 3:139909131-139909153 AGGGTGGGAAGCAGTGAGAGGGG - Intergenic
963218058 3:142773438-142773460 CGGAAGTAAAGCAGGGTAAGAGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965087427 3:164116638-164116660 TGGTAGTGAAGAAGTGTAAATGG + Intergenic
965296604 3:166955363-166955385 AGGGAGTGAAGCGGAGTCTGTGG + Intergenic
965735935 3:171820966-171820988 AGGGAGTGGAGGAGGGTAAAAGG + Intergenic
966480101 3:180398130-180398152 AGGGAGGGAATCAGTGAAAAAGG + Intergenic
967197618 3:187042421-187042443 AGGGAGTGGAAGAGTGGAAGAGG + Intronic
967927346 3:194661921-194661943 AGGGACATAAACAGTGTAAGAGG + Intronic
969634982 4:8363566-8363588 AGGGAGGGGAGCAATGTCAGAGG + Intergenic
971446213 4:26752060-26752082 AGAGAGTGAGGCATAGTAAGTGG - Intronic
974927924 4:68324341-68324363 AGGGAATTAACCACTGTAAGTGG - Intronic
976897099 4:90126618-90126640 AGGAAATGAGGCAGTGCAAGGGG + Intergenic
976989055 4:91341325-91341347 ATTGAGTAAAGCAGTGTAATAGG + Intronic
977070999 4:92387631-92387653 AGGGAGGAAGGAAGTGTAAGTGG + Intronic
978595475 4:110373062-110373084 GGGGAGAGAAGCAGAATAAGAGG + Intronic
979401971 4:120260030-120260052 AGGCATTGAAACAGTGAAAGAGG + Intergenic
980474199 4:133290246-133290268 AGGGATTGAATCTGTGTAATTGG + Intergenic
981899523 4:149846175-149846197 AGGGAGTGAGGCAGGAGAAGAGG - Intergenic
983426718 4:167593516-167593538 AGGGAGGGAAGGAGAGAAAGAGG - Intergenic
985816532 5:2132038-2132060 AGGGAGGGACGCCCTGTAAGTGG - Intergenic
987325299 5:16806830-16806852 GGGGAGTGAAGCAGTGCCAGGGG - Intronic
987899602 5:23994511-23994533 GTCGAGTGAAGCAGTGGAAGTGG + Intronic
988638200 5:33010749-33010771 AGGGACTGAAGCACTGGAAAGGG + Intergenic
989060161 5:37402915-37402937 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
990644723 5:57831334-57831356 AGGATGTCAAGCAGTGTGAGTGG + Intergenic
992332218 5:75729052-75729074 AGAGAGTGAAGGAGAGTAAGAGG + Intergenic
992865889 5:80956854-80956876 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
993005908 5:82428060-82428082 AGGCGTTGAAGCATTGTAAGGGG + Intergenic
994667800 5:102727747-102727769 AGGTAGTGAATCAGTTTAATTGG + Intergenic
994710045 5:103255805-103255827 AGGGAGGGAACCAGTGTATAGGG + Intergenic
995243248 5:109909165-109909187 ATGGAGGGGAGCAGTGCAAGTGG - Intergenic
995375794 5:111472839-111472861 AGGGTGGGAACCAGTGTAGGTGG - Intronic
995630721 5:114129188-114129210 AGGGAGAAAAGGAGAGTAAGGGG - Intergenic
998145536 5:139725666-139725688 AGGAAGAGAAGCAGTGAAGGAGG - Intergenic
1001309374 5:170599885-170599907 AGGGAGTGAATCACTTTAAAAGG - Intronic
1001796405 5:174505810-174505832 GGGGAGAGAAGCAGTGAAATTGG + Intergenic
1003094054 6:3128613-3128635 ATGGAGTGAAGCAGGGTATCTGG - Intronic
1003197239 6:3925951-3925973 AGGGAGAGAAGCAGTATGTGGGG + Intergenic
1003267960 6:4583125-4583147 AGGAACTGACTCAGTGTAAGAGG + Intergenic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1004638652 6:17492761-17492783 AAGGAGTGAAGCAGTACAAAGGG - Intronic
1006174372 6:32113112-32113134 AGACAGTGAAGCAGTGGATGGGG + Intronic
1006621393 6:35367098-35367120 AGGAAATGGAGGAGTGTAAGAGG + Intronic
1007744370 6:44034468-44034490 AGGGAGAGAGGCAGGGGAAGGGG + Intergenic
1007924523 6:45640748-45640770 AGGGAGGGAAGAAAAGTAAGCGG - Intronic
1008497951 6:52152118-52152140 AGGGAGGGAAGGAGTGAGAGAGG + Intergenic
1008709617 6:54208835-54208857 AGGGAGGGAGGCAGTGTATTTGG - Intronic
1010066806 6:71691805-71691827 GAGGAATGAAGCAGAGTAAGAGG + Intergenic
1011207090 6:84911498-84911520 AAGGAATGAATGAGTGTAAGAGG - Intergenic
1011400321 6:86954281-86954303 AGTGAGAGAAGCAGAGTAAGAGG - Intronic
1012201489 6:96411675-96411697 AGAGAGTGAAGAAGAGAAAGAGG - Intergenic
1013106442 6:107029924-107029946 AGAAAGTGGAGCAGGGTAAGGGG - Intronic
1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG + Intronic
1017340012 6:153310145-153310167 AGAAAGTGAAACAGTGGAAGGGG - Intergenic
1017681189 6:156865776-156865798 AAGGAGGGAAGCAGTCTTAGAGG - Intronic
1017744229 6:157432480-157432502 ATGGTGTGAAGCTGTGGAAGAGG + Intronic
1019183783 6:170209207-170209229 AGGGAGTAAAGCAGGGCAGGAGG - Intergenic
1019932200 7:4230994-4231016 AGGGAGTGAGGCAGGGGAGGAGG + Intronic
1020365619 7:7377931-7377953 AGGGAAAGAAGGAGTCTAAGAGG + Intronic
1021133015 7:16934060-16934082 AGGTAGTGGAGCAGAGGAAGTGG - Intergenic
1021598065 7:22337771-22337793 GGGGAATACAGCAGTGTAAGAGG + Intronic
1021746736 7:23748535-23748557 AGAGAGGGAAGAAGTGGAAGGGG - Intronic
1021855184 7:24848172-24848194 AAGGAGTGAAGGTGTGTGAGGGG + Intronic
1025909997 7:65820579-65820601 AGGGAGTGAAGCAGGCGAGGAGG + Intergenic
1027769998 7:82394322-82394344 AGGGAGGGAAGAAGGGAAAGTGG + Intronic
1029931928 7:104381547-104381569 AGGGAGTGAGGGAGGGAAAGAGG - Intronic
1031803067 7:126273653-126273675 AGAGAGTGAACAAGTGAAAGGGG + Intergenic
1032194528 7:129781397-129781419 AGGGGGTGAGGCAGTGGAAGCGG + Intergenic
1032319768 7:130875329-130875351 AAGGAGGGAGGCAGTGTGAGAGG + Intergenic
1033076937 7:138258456-138258478 AGGAAGTGACTCAGTGCAAGAGG + Intergenic
1033148543 7:138892384-138892406 AGGGAGTTAACCAGTGTAGACGG - Intronic
1033646359 7:143307763-143307785 AAGGAATGCTGCAGTGTAAGGGG - Intergenic
1033989226 7:147263686-147263708 AAGGAGTGAAGCAGACTGAGGGG + Intronic
1034302730 7:150030759-150030781 AGTGAGTGAGGCAGCTTAAGTGG - Intergenic
1034803329 7:154066539-154066561 AGTGAGTGAGGCAGCTTAAGTGG + Intronic
1035255929 7:157627343-157627365 AGGGAGTGAGCCAGTGAAGGCGG + Intronic
1035392312 7:158513066-158513088 AGAGAGTGCAGCAGGGAAAGAGG + Intronic
1036961045 8:13244854-13244876 AGTGAGTGAAGAGGTGTGAGAGG - Intronic
1038702321 8:29860168-29860190 AGAGAATAAAGCAGGGTAAGAGG - Intergenic
1038916188 8:32025991-32026013 AGAAAGTGAAGCAGGGAAAGAGG - Intronic
1040849205 8:51881080-51881102 AGTAAGTGAAGCAGTGTTCGTGG - Intronic
1042874721 8:73430441-73430463 AGGGGGTGATGAAGTGTGAGAGG - Intronic
1045885406 8:107091181-107091203 AGGGAGTGAAAAAGTGTATTGGG - Intergenic
1046738597 8:117804683-117804705 AGTGAGTGAAGCAAGGGAAGAGG + Intronic
1047129016 8:121997278-121997300 AGGGAGTCAAGAAGTGTCAGAGG - Intergenic
1047136880 8:122089362-122089384 AGGGAGTGGAGGAGGGTAAAGGG + Intergenic
1047275038 8:123399373-123399395 AGGGAGTAAAGCAGTGAACCAGG + Intronic
1047653408 8:126948960-126948982 AGGGAATGCAGCAGTAAAAGAGG - Intergenic
1048302185 8:133259943-133259965 GGGCAGGGAAGCAGTGTATGCGG + Intronic
1049070966 8:140355699-140355721 AGGGAGACAAGCAGTCTAATGGG + Intronic
1049337675 8:142095103-142095125 AGGGAATGGAGGAGTGTGAGGGG + Intergenic
1049589988 8:143453975-143453997 AGAGAGTGAAACAGTGGAAAGGG - Intronic
1051947836 9:22593262-22593284 AGGGAATAAAGCAGATTAAGGGG + Intergenic
1051997563 9:23236326-23236348 CCGGAGTGGAGCATTGTAAGTGG + Intergenic
1052218254 9:25991956-25991978 GGGTAATGAAGCAGTTTAAGTGG - Intergenic
1055504334 9:76932484-76932506 AGGGAGTGAAGCAGTCAAGCTGG + Intergenic
1055766060 9:79664706-79664728 AGGGAGGGAAGAAGTGGCAGCGG - Intronic
1055969749 9:81900287-81900309 AGGGAGGGAAGCAGGGAAGGAGG - Intergenic
1057226068 9:93293844-93293866 AGGGAGAGAAGGAATGAAAGGGG - Intronic
1058214480 9:102216866-102216888 AGGAACTGACTCAGTGTAAGAGG - Intergenic
1058784089 9:108368570-108368592 AGAGAGTGAAGGAGTGAAATTGG - Intergenic
1059381629 9:113931530-113931552 TGGGAGTGATGAAGTGTCAGGGG + Intronic
1059382701 9:113939769-113939791 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1059841480 9:118222472-118222494 ATGGAGTGAAGCAAGGGAAGAGG + Intergenic
1061246062 9:129401780-129401802 AGGGAGAGAAGGAGGGAAAGAGG - Intergenic
1186892021 X:13968306-13968328 AGAGAGTGAGGGAGTGAAAGAGG + Intergenic
1187742167 X:22367586-22367608 AGGAAGTGATACAGTGTGAGAGG + Intergenic
1188032955 X:25284820-25284842 CGGGATTGAAGCTGGGTAAGTGG + Intergenic
1188400051 X:29733034-29733056 AGGGAGGGAGGCAGAGGAAGAGG + Intronic
1189590501 X:42506132-42506154 AGGGAGTGAGGCAGGGTTTGGGG + Intergenic
1189706775 X:43766853-43766875 AGGGAGTGAAGGAGGATAATTGG + Exonic
1190972721 X:55367396-55367418 AGAGGGTGAAGCTGTGGAAGGGG + Intergenic
1190979406 X:55442696-55442718 AGGGAGAGAAACAGGTTAAGTGG - Intergenic
1191174604 X:57485412-57485434 TTGGTGTGAAGCAGTATAAGTGG + Intronic
1192446777 X:71216806-71216828 AGAGAGAGAAGCAGGGGAAGGGG + Intronic
1195217533 X:102715271-102715293 TGGGACTGAAGCAGTGTCACAGG + Exonic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1196387831 X:115177563-115177585 AGGGATTGAAACAGAGTCAGGGG - Intronic
1196906741 X:120444458-120444480 AGGGAGATAAGGAGAGTAAGTGG - Intronic
1197708824 X:129652267-129652289 AGGCAGTGGAGGAGTGTACGTGG + Intronic
1198368404 X:135967023-135967045 AGGGATGGAAGGAGTGAAAGGGG + Intronic
1198951575 X:142078155-142078177 AGGGAGGGCAGCAGTGTATTGGG + Intergenic
1199319663 X:146423190-146423212 AGGGAGGGCAGCAGTGTATTGGG + Intergenic
1200228134 X:154430665-154430687 AGGGAAGGAAGCAGGCTAAGGGG + Intronic
1201568232 Y:15388438-15388460 AGGGAGAACAGCAGTGTAAATGG - Intergenic