ID: 1122891154

View in Genome Browser
Species Human (GRCh38)
Location 14:104732869-104732891
Sequence ACCACATATGTGCCGAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122891149_1122891154 1 Left 1122891149 14:104732845-104732867 CCATGACCCCAGCGGAGAGGAAT 0: 1
1: 0
2: 2
3: 2
4: 152
Right 1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 99
1122891151_1122891154 -6 Left 1122891151 14:104732852-104732874 CCCAGCGGAGAGGAATTACCACA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 99
1122891150_1122891154 -5 Left 1122891150 14:104732851-104732873 CCCCAGCGGAGAGGAATTACCAC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 99
1122891152_1122891154 -7 Left 1122891152 14:104732853-104732875 CCAGCGGAGAGGAATTACCACAT 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122891154 Original CRISPR ACCACATATGTGCCGAGGCA AGG Intronic
902168814 1:14594461-14594483 ACCACATATGAGCCGAGGCCTGG + Intergenic
904576180 1:31506443-31506465 TCCGCATGTGTGCCCAGGCATGG + Intergenic
906825066 1:48970740-48970762 CCCACATATGTGTCGCGGAAAGG - Intronic
906892912 1:49738080-49738102 ACCAAGTATGAGCCGAAGCAGGG + Intronic
908964826 1:69747330-69747352 AACACAAATGTGCAAAGGCATGG + Intronic
910291237 1:85602375-85602397 GCCACATGTGTGCAGGGGCAAGG + Intergenic
919830096 1:201534822-201534844 ACTACATATATGCAGAGGAAAGG - Intergenic
922822874 1:228495964-228495986 CCCACATATGTGCAGAGGGAGGG - Intergenic
923256581 1:232226578-232226600 CACACATCTGTGCAGAGGCATGG + Intergenic
1063119863 10:3097712-3097734 AACACACATGTGGCCAGGCATGG + Intronic
1071061595 10:81576431-81576453 ACCTCATGTGTGGCCAGGCATGG - Intergenic
1073731388 10:106292394-106292416 TCCACAGATGGGCAGAGGCAAGG + Intergenic
1074777400 10:116776157-116776179 GCCACAGAGGTGCTGAGGCAGGG - Intergenic
1075724282 10:124603674-124603696 GCCACATCAGTGCCGAGGCGAGG - Intronic
1077727103 11:4685430-4685452 ACATCATATGTGACTAGGCATGG + Intronic
1078616098 11:12867667-12867689 AGCACATTTGTGAGGAGGCAGGG + Intronic
1081292412 11:41342945-41342967 ACCAGAAATTTGCAGAGGCAAGG - Intronic
1089643141 11:119860752-119860774 ACCACATATGGGAGGAGGCAGGG - Intergenic
1092025794 12:5239155-5239177 TACAGATATGTGCTGAGGCAAGG - Intergenic
1093393981 12:18657324-18657346 ACCATATATGTGCCCAGGGATGG + Intergenic
1097491749 12:60280076-60280098 AACTCATATGTGGCCAGGCATGG - Intergenic
1101029113 12:100642786-100642808 ACCAAATGTGTGCCAAAGCAGGG - Intergenic
1109646467 13:65264550-65264572 CCCAGATGTGTGCCGAGACATGG - Intergenic
1110763725 13:79258661-79258683 AACACATGTGGGCTGAGGCAAGG - Intergenic
1113313488 13:109155140-109155162 ACAACATATGTGCTGAGCAAGGG - Intronic
1114478037 14:23011310-23011332 AACAAATATGTGCCCAGGCGCGG - Intergenic
1115637618 14:35305803-35305825 ACAAAATATGTGCCCAGGCCAGG + Intronic
1116222756 14:42110559-42110581 CCCAGACATGTGCCTAGGCATGG + Intergenic
1118285233 14:64465263-64465285 ACCACATCAGCGCCGAGGCGGGG - Intronic
1119804702 14:77475238-77475260 AACACTTATGTGCAGAGCCAGGG + Exonic
1122891154 14:104732869-104732891 ACCACATATGTGCCGAGGCAAGG + Intronic
1124901947 15:33832362-33832384 ACCACATATGTGGCCGGGCACGG + Intronic
1127681811 15:61305034-61305056 AGCACATAGGAGCCAAGGCAGGG + Intergenic
1128197411 15:65772416-65772438 ACCAGATATTTGGCCAGGCACGG + Intronic
1128737838 15:70063379-70063401 ACCACATTTGGGCTGAGGAATGG - Intronic
1138662666 16:58533245-58533267 ACCACTTATGTGGCCAGGCATGG + Intronic
1138662761 16:58533837-58533859 ACCACTGATGTGGCCAGGCATGG + Intronic
1143276436 17:5714820-5714842 CCCACAAATATGCCGAGGCAGGG - Intergenic
1144477933 17:15604825-15604847 AACACATATGTGGCCAGGCGTGG - Intronic
1146547474 17:33751278-33751300 ACCACATTGGTGCCGTGTCAGGG - Intronic
1148680561 17:49471118-49471140 CCCACATCTGGGCCGAGGCAGGG + Intronic
1151168146 17:72222484-72222506 ATCACATATGAGGCCAGGCACGG - Intergenic
1156015330 18:32540938-32540960 ACCACACATGTGCCAAGGGATGG - Intergenic
1156357617 18:36355857-36355879 ACCACAAATGTTCCTAGGAAAGG - Intronic
1156932302 18:42660478-42660500 ACCAGGCATGAGCCGAGGCAGGG + Intergenic
1159320297 18:66839147-66839169 CCCAGAGATGTGCCTAGGCATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
925650284 2:6082082-6082104 ACCACATATCTGGGGAGGCTTGG - Intergenic
926620957 2:15047279-15047301 ACCACATCTCTGCAGAGGCAAGG - Intergenic
926946946 2:18198719-18198741 TGCACATATGAGCCCAGGCAAGG - Intronic
927275680 2:21260433-21260455 ATCACATATGGCCAGAGGCAGGG - Intergenic
928022887 2:27717236-27717258 AGCACATATGTGCGTGGGCAGGG - Intergenic
932075202 2:68656175-68656197 ACCACCTATGTGCAGAGCCCTGG - Intergenic
933543037 2:83672522-83672544 ACCTCATATGGGGCCAGGCATGG - Intergenic
939559284 2:143714221-143714243 ACCACATAGCTGCCAAGGCTTGG + Intronic
942978077 2:182043505-182043527 TCCACATATATGCCCAGACATGG + Intronic
1171257547 20:23701542-23701564 CCCAGAGATGTGCCTAGGCATGG - Intergenic
1172252187 20:33487764-33487786 AGAACATATGTGGCCAGGCATGG - Intergenic
1173048384 20:39534989-39535011 ACCACATGTGGGCAGAGGAAAGG - Intergenic
1177989524 21:28020537-28020559 ACTATATATGTGGCCAGGCACGG - Intergenic
1182258251 22:29053515-29053537 ACCACACATGGGACCAGGCAAGG - Intronic
1183539382 22:38420830-38420852 ATCCCATATGTGACCAGGCATGG - Intergenic
1184108861 22:42383753-42383775 ACCCCAAATGTGCCCAGGGAGGG - Exonic
960747104 3:120902172-120902194 ACCACGCATGAGCCGAAGCAGGG - Intergenic
962875639 3:139534152-139534174 AACACATATGTGCTTTGGCAGGG - Intronic
963676267 3:148315445-148315467 ACCACCTAGGAGCCAAGGCATGG - Intergenic
969905900 4:10395907-10395929 CCCAGATGTGTGCCTAGGCATGG + Intergenic
971337641 4:25738802-25738824 ACCACTTAGGTTCTGAGGCAGGG - Intergenic
974142873 4:57909967-57909989 ACCACATCTGTGGCCAGACACGG + Intergenic
975472042 4:74781125-74781147 ACCACATGTGTGTACAGGCAGGG + Intronic
977108713 4:92922313-92922335 ACCAAACATGAGCCGAAGCAGGG - Intronic
977525079 4:98134918-98134940 ACAAACTATGTGCCTAGGCAAGG - Intronic
980872951 4:138631044-138631066 AGCACATATATGACAAGGCAAGG + Intergenic
982590383 4:157301882-157301904 GCCACATATTTGGCCAGGCATGG + Intronic
987306009 5:16638572-16638594 ACCGCATGTGAGCCGAAGCAGGG - Intergenic
989098974 5:37807262-37807284 ACCACAACTGTGCCATGGCAGGG + Intergenic
991475140 5:67010949-67010971 GCCACGAATGTGCAGAGGCAAGG - Intronic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
999375754 5:151085612-151085634 GCCACGTATGTGACGAGGCTGGG - Intronic
999591178 5:153148283-153148305 CCCAGAGATGTGCCTAGGCATGG - Intergenic
1004227647 6:13801557-13801579 AACACATATCTGGCCAGGCAAGG + Intronic
1008978666 6:57457754-57457776 ACCGTATGTGAGCCGAGGCAGGG - Intronic
1013048500 6:106510579-106510601 ACCACACGTGTGGCGAGGAACGG + Intergenic
1018488356 6:164266013-164266035 GCCACATGTGTGCTGATGCATGG + Intergenic
1020194270 7:6025289-6025311 ACCACATCTGTGGCTGGGCATGG + Intronic
1020845410 7:13275068-13275090 ACCCCATCTGTGCAGAGGAATGG - Intergenic
1023755049 7:43408409-43408431 ACCACTTATTTGGCCAGGCAAGG + Intronic
1026411319 7:70126126-70126148 ACCAAATATGTGGCCAGGCATGG + Intronic
1032609611 7:133397934-133397956 ACCACTTAATAGCCGAGGCAAGG - Intronic
1034968523 7:155405646-155405668 TCCACCTGTGTGCTGAGGCACGG + Intergenic
1041054060 8:53964557-53964579 GCCACATATGAGGCCAGGCACGG - Intergenic
1041463684 8:58138341-58138363 CCCACACATGTGCCGGGGAAAGG - Intronic
1043655701 8:82662782-82662804 ACCAGAGGTGTGCCTAGGCATGG + Intergenic
1044054580 8:87552810-87552832 ATTACATATGTACCCAGGCAGGG - Intronic
1044366435 8:91352215-91352237 AAAACATATGTGCTGGGGCAAGG + Intronic
1049028962 8:140018615-140018637 ATCACTTATGTGGCCAGGCACGG - Intronic
1050295240 9:4197521-4197543 CCCAGATATGTGCCTAGGCATGG - Intronic
1051619917 9:19040059-19040081 ACCTTATATGTTCCAAGGCACGG + Intronic
1055426109 9:76198591-76198613 ATCACATATGTTGCAAGGCAAGG + Intronic
1061225429 9:129278485-129278507 ATCAAATATGTACCGATGCATGG - Intergenic
1190966185 X:55303611-55303633 ACCAAGTATGAGCCGAAGCAGGG - Intergenic
1191226256 X:58047734-58047756 ACCACAAATTTGCCAGGGCAGGG - Intergenic
1192201927 X:69071617-69071639 AGGACATATCTGCCGAGGGAAGG - Intergenic
1192917231 X:75665879-75665901 CCCAGAGATGTGCCTAGGCACGG + Intergenic
1195786358 X:108527856-108527878 ACCACATATGGGCCTGGACATGG + Intronic
1199679404 X:150214963-150214985 CCCACATCTGTGCTGTGGCAGGG + Intergenic
1199695823 X:150342086-150342108 CCCACATCTGTGCTGTGGCAGGG - Intergenic