ID: 1122891164

View in Genome Browser
Species Human (GRCh38)
Location 14:104732913-104732935
Sequence TGGGGGTCACAGCACCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122891164_1122891172 7 Left 1122891164 14:104732913-104732935 CCAGGAGGGTGCTGTGACCCCCA 0: 1
1: 0
2: 6
3: 19
4: 259
Right 1122891172 14:104732943-104732965 AATCTGTTCGAGTCACGCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1122891164_1122891174 25 Left 1122891164 14:104732913-104732935 CCAGGAGGGTGCTGTGACCCCCA 0: 1
1: 0
2: 6
3: 19
4: 259
Right 1122891174 14:104732961-104732983 CAGGGCCTGCCCCGTCCCGATGG 0: 1
1: 0
2: 1
3: 17
4: 187
1122891164_1122891171 6 Left 1122891164 14:104732913-104732935 CCAGGAGGGTGCTGTGACCCCCA 0: 1
1: 0
2: 6
3: 19
4: 259
Right 1122891171 14:104732942-104732964 GAATCTGTTCGAGTCACGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122891164 Original CRISPR TGGGGGTCACAGCACCCTCC TGG (reversed) Intronic
900185259 1:1330428-1330450 TCGGGGACACAGCAGACTCCAGG - Intergenic
900243287 1:1626801-1626823 AGGGGGTCACAGCAGGCTGCAGG - Intronic
900605282 1:3521100-3521122 GCGGGGTCACGACACCCTCCCGG + Intronic
901058429 1:6460486-6460508 TGCGGGGCTCAGCCCCCTCCAGG + Exonic
901385889 1:8908970-8908992 TGGGAGCCACTGCACCCACCAGG + Intergenic
902187096 1:14733673-14733695 CGGGGGTCATAGCAGCTTCCTGG + Intronic
902636514 1:17738304-17738326 TGTGGGTGACACCACCCACCAGG - Intergenic
902674745 1:18000950-18000972 TGGGGGTCAGAGAAGGCTCCTGG + Intergenic
903417532 1:23194114-23194136 TTGGGATCCCAGGACCCTCCAGG - Exonic
903672502 1:25045087-25045109 CCTGGGTCACAGGACCCTCCTGG - Intergenic
903921392 1:26803547-26803569 GGGGGGTCAGCGCCCCCTCCCGG - Intergenic
904882499 1:33711633-33711655 CGAGGCTCACAGCACCCTCATGG + Intronic
905241806 1:36586434-36586456 TGAGGGTCACAGCCAGCTCCTGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906316605 1:44790446-44790468 TGTGGCTCAGAGCACCCTCTAGG + Intergenic
907868179 1:58419018-58419040 TGGGGCCTCCAGCACCCTCCTGG + Intronic
911070630 1:93829314-93829336 TGGGTGTCACAGCAGCCTCCAGG - Intronic
915087417 1:153397898-153397920 TGGGGGTCACAGCCCCGCCTGGG - Intergenic
917888181 1:179408704-179408726 TGGGGTTCACTGTATCCTCCAGG + Intronic
918073524 1:181151643-181151665 TGGAGGTCAAAGCAGCCTCGTGG - Intergenic
922062288 1:222104177-222104199 TTGGGGTCCCAGCATCCTGCAGG + Intergenic
923600604 1:235399477-235399499 TGTGGGTCATAAGACCCTCCCGG + Intronic
923684798 1:236146549-236146571 GGGGGGTAACAGTACCCTCTGGG - Intronic
1062855353 10:777375-777397 TTGGGGTCACAGCCCACGCCGGG - Intergenic
1062855373 10:777424-777446 TTGGGGTCACAGCCCACGCCGGG - Intergenic
1062855410 10:777521-777543 TTGGGGTCACAGCCCACGCCGGG - Intergenic
1063201471 10:3788136-3788158 TGGGGGCCACTTCACCCCCCTGG + Intergenic
1063268078 10:4475997-4476019 TGGCGCTCACAGCACCAGCCAGG + Intergenic
1065496356 10:26332742-26332764 TGCTGGACACAGCACCGTCCTGG - Intergenic
1065840533 10:29697144-29697166 GGGGGGTCAGCGCCCCCTCCCGG + Intronic
1067474113 10:46555424-46555446 GTGGGGATACAGCACCCTCCAGG + Exonic
1069913412 10:71773204-71773226 TAGGGGTCCCAGCAGCCTCTGGG + Intronic
1071603843 10:86971518-86971540 TGGTGTTCCCAGCACCCCCCCGG + Intronic
1075002897 10:118810927-118810949 TGGGGGCCCCAGCATCCTGCTGG + Intergenic
1075086203 10:119415915-119415937 TGGAGATCAGAGGACCCTCCAGG - Intronic
1075342135 10:121655614-121655636 TGGCGGTCACAGCACTGGCCTGG - Intergenic
1075517055 10:123117846-123117868 TGGGGGTCCCAGCACCTGGCTGG + Intergenic
1075842824 10:125518603-125518625 TGGGGGGGACAGCGCCCGCCCGG + Intergenic
1076334009 10:129692846-129692868 TGAGGGTGGCAGCTCCCTCCAGG - Intronic
1076445853 10:130513317-130513339 AGGGGCTCACAGCACCCACGAGG + Intergenic
1076907126 10:133368396-133368418 TCAGGGTCTCAGCTCCCTCCTGG + Intronic
1078092911 11:8278370-8278392 TGGAGGTCACAGCTACCACCTGG + Intergenic
1078459298 11:11501225-11501247 TGGTGTGCACAGCACCCTCGTGG + Intronic
1078570540 11:12453913-12453935 TGGGGGACACAGCATCTCCCTGG + Intronic
1079318802 11:19432661-19432683 TGGGGGCCCCAGCTCCTTCCTGG - Intronic
1081789707 11:45774299-45774321 TAGGGGTCTCTCCACCCTCCAGG + Intergenic
1082023309 11:47552873-47552895 CGCGGGTCACAGGGCCCTCCGGG - Intronic
1083718786 11:64593800-64593822 AGTGGGGCACAGCACCCACCAGG - Exonic
1084316110 11:68346865-68346887 TGGGGGTTGCTGGACCCTCCTGG + Intronic
1084506088 11:69569460-69569482 TGGGGGGCTCTGCAGCCTCCTGG - Intergenic
1088276846 11:108096415-108096437 TGTGGCTCACTGCATCCTCCTGG - Intronic
1089620819 11:119721231-119721253 AGGAGGACACAGCTCCCTCCAGG - Intronic
1090666315 11:128917053-128917075 TGGGTCTCACAGACCCCTCCAGG + Exonic
1091712982 12:2754901-2754923 TGGGGGAAACAGCACCCTGGAGG + Intergenic
1092356317 12:7798300-7798322 CTGGGGTCACTGCAACCTCCCGG - Exonic
1096498497 12:52051904-52051926 TGGGGGTCACAGCACCGTGGGGG + Intronic
1098847958 12:75561406-75561428 TGGGGAGCCCAGCACACTCCTGG + Intergenic
1100108750 12:91210768-91210790 TGGAGGTCACAGCTGCATCCTGG - Intergenic
1102466495 12:113133677-113133699 TGGAGCTCCCAGCAGCCTCCAGG + Intronic
1102521682 12:113481210-113481232 TGGTCTTCTCAGCACCCTCCAGG + Intergenic
1103901013 12:124303633-124303655 TGGGGGGCTCAGCATCCGCCTGG - Intronic
1104430650 12:128713367-128713389 TGGGGGTCACTAGACCCTGCAGG - Intergenic
1104674846 12:130705454-130705476 TGTGGGCCACAGAAGCCTCCTGG + Intronic
1104859951 12:131918624-131918646 CGAAGGTCACAGCCCCCTCCAGG - Exonic
1106552652 13:30785342-30785364 TGGGCATCACAGCACCAGCCAGG + Intergenic
1107711179 13:43151955-43151977 TGGAGGGCACAGCAGCCTCGAGG - Intergenic
1108738378 13:53309034-53309056 TCAGGGACACAGCACCTTCCTGG + Intergenic
1109531889 13:63660347-63660369 TGTGAGCCACAGCACCCACCTGG + Intergenic
1112457430 13:99575428-99575450 TGGAGGACACAGCCCCCTCCAGG - Intergenic
1113520179 13:110935054-110935076 TGGGTGAGACAGCATCCTCCTGG + Intergenic
1113791241 13:113029594-113029616 CCGGGGACACAGCACCCTCAGGG - Intronic
1114936821 14:27549016-27549038 TGCAGGGTACAGCACCCTCCTGG - Intergenic
1117304379 14:54459515-54459537 TGCAGGATACAGCACCCTCCCGG - Intergenic
1118780493 14:69004568-69004590 TGGAACTCACAGCATCCTCCAGG - Intergenic
1119715052 14:76853209-76853231 TCAGGGTCACATTACCCTCCAGG - Exonic
1121315897 14:92960834-92960856 TGGTGCTGGCAGCACCCTCCAGG - Intronic
1122129495 14:99596885-99596907 TGGAGGGCACAGCAGCCACCTGG + Intronic
1122155782 14:99749649-99749671 TGGGGCTCACAGAAACCTCCAGG - Intronic
1122535532 14:102459384-102459406 TGGGAGTCACATCATCCACCAGG - Intronic
1122772623 14:104104114-104104136 TGGGGGGAGCAGCCCCCTCCAGG + Intronic
1122780377 14:104140960-104140982 CCGGGGGCACAGCACCCTGCAGG - Intronic
1122891164 14:104732913-104732935 TGGGGGTCACAGCACCCTCCTGG - Intronic
1122906412 14:104803593-104803615 TGGGAGTCGCAGCACCCTAGGGG + Exonic
1123019247 14:105389887-105389909 TGGTGGGCACAGCTCCCTCTTGG - Intronic
1123427023 15:20180914-20180936 TGGGGCTGACAGCACATTCCTGG + Intergenic
1123536252 15:21187423-21187445 TGGGGCTGACAGCACATTCCTGG + Intergenic
1123666138 15:22610624-22610646 TGGTGACCACAGCACCCCCCAGG - Intergenic
1124319961 15:28705030-28705052 TGGTGACCACAGCACCCCCCAGG - Intronic
1124482549 15:30090387-30090409 TGGTGACCACAGCACCCCCCAGG + Intronic
1124489005 15:30142489-30142511 TGGTGACCACAGCACCCCCCAGG + Intronic
1124754525 15:32395834-32395856 TGGTGACCACAGCACCCCCCAGG - Intronic
1125257586 15:37783338-37783360 TGGAGTTCCCAGAACCCTCCAGG - Intergenic
1130988471 15:88860314-88860336 TGGGGGTTGCAGCCCCCGCCAGG + Exonic
1131033157 15:89203424-89203446 TGGGGGTGGTAGAACCCTCCTGG - Intergenic
1132205605 15:99984185-99984207 CGGGGGTCACCTCAGCCTCCTGG - Intronic
1132602582 16:780221-780243 TGGGGGTCACAGGTCCACCCTGG - Intronic
1132603080 16:782545-782567 TGTGGGTCACTGCCTCCTCCTGG + Intronic
1132788198 16:1669888-1669910 TGAGGGACCCAGCACCCTGCAGG + Intronic
1133156346 16:3879781-3879803 TGGGGGTGACAGCGCGCCCCGGG + Intronic
1133264429 16:4574915-4574937 TGGGGGACACTGCCCCCTCCAGG + Intronic
1135342861 16:21664035-21664057 CGGGGGTCACAGTCCCCGCCTGG - Intergenic
1135774683 16:25246603-25246625 TGTGTGTGACAGCACCCCCCGGG + Intronic
1136504405 16:30693740-30693762 TGGGGGTTACAGAACCATCAAGG - Intergenic
1136717286 16:32290604-32290626 TGGGGGACACAGCTGCCTCAGGG + Intergenic
1136835661 16:33496858-33496880 TGGGGGACACAGCTGCCTCAGGG + Intergenic
1137265799 16:46868157-46868179 TGCAGGGCACAGCCCCCTCCCGG + Intergenic
1137686701 16:50391589-50391611 TGGGAGCCACAGCGCCCTCGTGG + Intergenic
1140933903 16:79653197-79653219 TGGAGGTCACAGCTCCATCTTGG + Intergenic
1141111634 16:81275299-81275321 TGGGGGTCTCAGGGCTCTCCAGG - Intronic
1203009143 16_KI270728v1_random:227174-227196 TGGGGGACACAGCTGCCTCAGGG - Intergenic
1203145840 16_KI270728v1_random:1797173-1797195 TGGGGGACACAGCTGCCTCAGGG + Intergenic
1142914466 17:3124687-3124709 TGGGGGTCACAGGATCCACTTGG - Intergenic
1142961416 17:3554548-3554570 TGGGGAGCACAGCACACTCAGGG - Intronic
1143501760 17:7343433-7343455 TGTGGGTCAGGGCAGCCTCCAGG - Exonic
1143787468 17:9266674-9266696 TGGGGGCCAAAGTAGCCTCCAGG - Intronic
1144029223 17:11304625-11304647 TGGGGACCACAGCACCCTTTAGG + Intronic
1145773223 17:27508388-27508410 TGGACATCACAGCACCTTCCAGG - Intronic
1146981561 17:37166758-37166780 TGGGGATGACAGCACCTTTCTGG + Intronic
1147457626 17:40548019-40548041 TGGGGGTCACAGCCCCTGGCAGG + Intergenic
1147722139 17:42545927-42545949 TTGGGGTTACATCACCCTCCAGG + Intergenic
1148857594 17:50587234-50587256 TGGAGGTCACATCACCCTCCTGG - Intronic
1149303220 17:55324576-55324598 CTGGGGTCTCAGCACCCTGCAGG + Exonic
1150796083 17:68238139-68238161 AGAGGATCACAGCATCCTCCAGG + Intergenic
1152241764 17:79164710-79164732 CGGGGGTCCAGGCACCCTCCTGG + Intronic
1152431923 17:80253050-80253072 TGGGGCTGGCAGCACCTTCCCGG + Exonic
1152527952 17:80900255-80900277 TGGTGGTCGCAGCTCTCTCCCGG + Intronic
1152658119 17:81529383-81529405 GGGGGGTCCCAGCACCCCTCAGG - Intronic
1152684791 17:81688660-81688682 TGAGGGTCGCAGGACACTCCAGG - Intronic
1152724703 17:81939486-81939508 TGAGGGTCTGAGCAGCCTCCTGG - Intronic
1152959289 18:68853-68875 TACGGGACACAGCAGCCTCCTGG + Intronic
1154012640 18:10588976-10588998 AGGGGGTCGCATCACCTTCCAGG + Intergenic
1154079142 18:11237123-11237145 CAGGGGTCACCTCACCCTCCTGG + Intergenic
1155516430 18:26627976-26627998 TGGGGGCCAAGGCAACCTCCCGG - Intronic
1158020543 18:52836677-52836699 TGCAGGGCACAGCCCCCTCCTGG + Intronic
1160378548 18:78431535-78431557 TGGGGCTCTCAGCACCTCCCAGG - Intergenic
1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG + Intronic
1161979508 19:7623375-7623397 CAGGGGCCACAGCACCCTCCAGG - Intronic
1161979532 19:7623476-7623498 GGAGGGTCACAGCTCTCTCCTGG - Intronic
1161999009 19:7731374-7731396 TGGGGGACGCTGCACCCCCCGGG - Intronic
1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG + Intronic
1164192393 19:22926825-22926847 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192622 19:22927358-22927380 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192803 19:22927763-22927785 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164648131 19:29873720-29873742 TGGGGGTCTGAGCACCAGCCTGG - Intergenic
1166191966 19:41181104-41181126 TGGGGGGGACAGCCCCCGCCCGG + Intergenic
1166764970 19:45247368-45247390 TAGGGATCACAGCTCCCTCCTGG + Intronic
1167005720 19:46775371-46775393 CAGGGGCCCCAGCACCCTCCAGG - Exonic
1168121845 19:54256136-54256158 TGGGGGTCACGGGACCCACAGGG + Exonic
1168129889 19:54311507-54311529 TGGGGGTCACAGGGCCCACAGGG + Exonic
1168176561 19:54631549-54631571 TGAGGGTCACAGGACTCCCCTGG - Exonic
925208557 2:2027237-2027259 CGGGAGGCAGAGCACCCTCCCGG + Intronic
925220317 2:2134189-2134211 TGGGAGTCTCACCTCCCTCCTGG + Intronic
925904407 2:8530938-8530960 TGGCACTCACAGCACCCGCCAGG + Intergenic
927149232 2:20186230-20186252 TGGAGATCACAGCATCCTGCCGG - Intergenic
927213730 2:20654073-20654095 TGGGGCTCACAGCCCACTGCAGG + Intergenic
927865288 2:26583969-26583991 TGGGGGACACAGCACCAGCCAGG + Intronic
928912984 2:36441464-36441486 TAGAGGTCACAGCACTCTCCCGG - Exonic
928986035 2:37182608-37182630 TGTGAGTCACCGCACCCTGCAGG + Intronic
930761827 2:55046932-55046954 AGGGGGTGACAGCACTCTCTTGG - Intronic
930960848 2:57259863-57259885 TGGTGGTGACAGCACCCTTAAGG + Intergenic
931235589 2:60410280-60410302 GGTGTGTCACTGCACCCTCCCGG + Intergenic
931463000 2:62464288-62464310 TGGGGGTCACAGCCCCCATCTGG + Intergenic
931668634 2:64627456-64627478 TGCAGAGCACAGCACCCTCCTGG - Intergenic
931752115 2:65339102-65339124 GGGGGGTCAGCGCCCCCTCCCGG + Intronic
932575821 2:72961886-72961908 CTGGGGTGACAGCACCCTCGGGG - Intronic
937155291 2:119714714-119714736 TGGGGGTCACTGCAAGCCCCAGG + Intergenic
938244854 2:129768503-129768525 TGGGGGTCTTAGCTCCATCCCGG + Intergenic
941769017 2:169327658-169327680 TGGGGGGCTCAGCCCCCTCCCGG + Intronic
943773670 2:191742640-191742662 GGGGGGTCAGCGCCCCCTCCCGG + Intergenic
946337960 2:219050870-219050892 TGGGGTTCAAGGGACCCTCCAGG - Intergenic
948854364 2:240723274-240723296 TGGGAGTCACAGCCACCTGCAGG - Intronic
1169254277 20:4085408-4085430 TGGGGCTCACAGCTGCCCCCTGG + Intergenic
1170803851 20:19612786-19612808 TGGGGCACAGAGCACCCACCAGG - Intronic
1171375057 20:24686859-24686881 TGGGGTTCACAGCAACCTAGAGG - Intergenic
1172174032 20:32961495-32961517 TGGGGGTCACTGACCCCTGCAGG - Intergenic
1172907351 20:38379181-38379203 TGGGGGTGTCAGCCCCCCCCCGG + Intergenic
1173226676 20:41166230-41166252 TGGGGGTCCCAGCATCTTGCCGG - Exonic
1175258159 20:57659166-57659188 TGGGCGTCTCATCTCCCTCCTGG + Intronic
1175892585 20:62322135-62322157 TGAGGGTCACAGCGGCCCCCAGG + Exonic
1176008818 20:62880970-62880992 TGTGGGCAGCAGCACCCTCCGGG + Exonic
1176146984 20:63569840-63569862 TGGGGGTGGCTGAACCCTCCTGG + Intronic
1176209884 20:63914183-63914205 TGTGGGTCACAGCACCTCCACGG - Intronic
1179195318 21:39157655-39157677 GGGGGGTCAGCGCCCCCTCCCGG + Intergenic
1181689575 22:24551111-24551133 TAGGGTTCACATCACCCTGCAGG - Intronic
1183596459 22:38815461-38815483 TGGGGGGAACAGCAGCCTCATGG + Intergenic
1183831289 22:40419511-40419533 TGGGGGGCATTGCACCCTCCAGG - Intronic
1184493503 22:44824085-44824107 TGGTGCTCGCAGCACCCACCAGG - Intronic
1184795720 22:46731377-46731399 TGGGGGGTACAGCTCCCGCCAGG - Intronic
1185018367 22:48358727-48358749 TTGGGGTCAGAACACCATCCAGG - Intergenic
1203216119 22_KI270731v1_random:6961-6983 TGGGGAACACAGCATTCTCCAGG + Intergenic
950615254 3:14152846-14152868 TTGGGTTCACTGCCCCCTCCTGG - Intronic
950743043 3:15064924-15064946 TGGGGGTAACAGCGCCGACCTGG + Intronic
951754677 3:26077244-26077266 TAGGGGTGACAGCAGCTTCCTGG - Intergenic
954386993 3:50249326-50249348 TGGGGCTCAAAGCACCCACTGGG - Intronic
954397272 3:50299421-50299443 TGCGCGTCACAACACCCGCCAGG + Exonic
954745908 3:52787465-52787487 TGGGGGTCTCAGCCCTCCCCTGG - Intronic
956667785 3:71658402-71658424 TGTGAGTCACAGCACCCACAAGG + Intergenic
961471321 3:127114937-127114959 TGGGGGTCTGAGCACACTCCTGG + Intergenic
961654015 3:128431776-128431798 TGGGGGTCACAACAGCCAACAGG + Intergenic
962737227 3:138336737-138336759 CGGGTGTCACAGCACCATCCAGG - Intergenic
962853033 3:139322200-139322222 TGAAGGTCACAGCTCCCTCCAGG + Intronic
963253184 3:143120421-143120443 TGGGGGTCCCCGCACCTTCGAGG - Exonic
966454812 3:180102611-180102633 TGGTGGTCACCCCTCCCTCCAGG - Intergenic
966914695 3:184578264-184578286 TGGTGGTCACAGCAGTCTCTGGG - Intronic
967856018 3:194118101-194118123 TGGGGGACACAGGCCCCTTCAGG + Intergenic
968454375 4:689491-689513 TGGGGTCCACAGCCCCCTTCAGG - Intergenic
968592256 4:1465065-1465087 TGGGGACCACAGCACCAACCTGG - Intergenic
969695900 4:8734711-8734733 TGGGAGTCACTCCACCTTCCTGG - Intergenic
975599899 4:76088150-76088172 TGGGGCTCCCTGCACCCTACAGG + Intronic
976350123 4:84051484-84051506 TGGGGGGTGCAGCAGCCTCCAGG + Intergenic
981959036 4:150513495-150513517 TTGGGAACACAGCACCCACCTGG + Intronic
983672385 4:170253314-170253336 TGGTGGTCACAGCAGAATCCAGG - Intergenic
985778400 5:1857178-1857200 TGGGGGCCGCAGCGGCCTCCAGG - Intergenic
985975892 5:3418851-3418873 TGCGCGGCACAGGACCCTCCAGG + Intergenic
989146089 5:38251539-38251561 TGGAGGTCACAGGACCCTGGAGG + Intergenic
989372342 5:40722815-40722837 TGGGGGGCGCAGCCCCCACCCGG + Intronic
991073650 5:62513398-62513420 GGGGGGTCAGCGCCCCCTCCCGG - Intronic
995922687 5:117332502-117332524 TGGGGGTCACAGGACTCATCTGG + Intergenic
996200954 5:120672399-120672421 TGGGTGGCACAGGAGCCTCCTGG + Intronic
997457620 5:134028908-134028930 TGTGGACCACAGCACTCTCCTGG + Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998039868 5:138945176-138945198 TGGTGGTCACAGAGGCCTCCAGG + Intergenic
998388928 5:141774450-141774472 TGGGGCTCACAGCCCCTCCCTGG - Intergenic
999434456 5:151552626-151552648 TGGGGGTCACAGAACCCTTCAGG - Intronic
1001548102 5:172583153-172583175 GGGGTGTCACAGAACACTCCCGG - Intergenic
1002060386 5:176622119-176622141 TGGGTGTCCCAGCTCCATCCAGG + Intronic
1002484243 5:179523782-179523804 TGGGGGTCACGACCACCTCCTGG - Intergenic
1002500332 5:179643706-179643728 TGGGGGTCACGACAACCTCCTGG + Intronic
1002764215 6:225665-225687 AGGGCGTCACAGCCCCTTCCCGG - Intergenic
1004520131 6:16354057-16354079 TGCCGGTCACACCACACTCCAGG + Intronic
1005606773 6:27484998-27485020 TGGGGGTGTCAGCCCCCGCCCGG - Intergenic
1006209899 6:32385300-32385322 TGGGGGGGTCAGCCCCCTCCCGG - Intergenic
1007647292 6:43392719-43392741 TGGGAGAGACAGCATCCTCCCGG + Intergenic
1008441867 6:51540823-51540845 TGGGTGTCACATGTCCCTCCGGG - Intergenic
1008535433 6:52503447-52503469 TGGGGAAGACAGGACCCTCCTGG - Intronic
1008971811 6:57377167-57377189 TGTGAGTCACCGCACCCTGCCGG + Intronic
1009160730 6:60278688-60278710 TGTGAGTCACCGCACCCTGCCGG + Intergenic
1011329158 6:86184332-86184354 TTGGGGACCCAGCAACCTCCCGG + Intergenic
1011952241 6:92981047-92981069 TGTGAGTCACCGCACCCTGCTGG + Intergenic
1012480219 6:99658522-99658544 TGGGGTTCCCAGTACCCTGCTGG + Intergenic
1014216350 6:118755933-118755955 TCAGGGTCACAGCCCACTCCAGG + Intergenic
1016597182 6:145815272-145815294 AACGGGTCACAGCACCGTCCTGG - Intergenic
1018469551 6:164083438-164083460 TGGAGGCTACAGCACCCTGCTGG + Intergenic
1018810297 6:167293894-167293916 TGGGGCACCCAGCACCCTCGTGG + Intronic
1019281276 7:201479-201501 TGGGGGTCCCAACACCCCGCAGG - Intronic
1019563089 7:1667525-1667547 TGGGGGAGACCGAACCCTCCTGG - Intergenic
1022531144 7:31067671-31067693 TGTGGGTCCCAGCACCCCCCCGG + Intronic
1023418043 7:39950441-39950463 TGGGGTACGCAGCAGCCTCCGGG - Exonic
1027185402 7:75968023-75968045 GGAGGGTCACAGCTCTCTCCTGG - Intronic
1030581105 7:111356949-111356971 TCGGGCTCACTGCAACCTCCTGG - Intronic
1031482027 7:122289645-122289667 TGGGGGTCACATGAACCACCGGG + Intergenic
1032851401 7:135798754-135798776 TCAGGGTCACTGCAGCCTCCAGG + Intergenic
1033056571 7:138060232-138060254 TGGGGGTCACACCACCCTCAGGG - Intronic
1035217562 7:157380093-157380115 TGTGAGCCACTGCACCCTCCCGG + Intronic
1035242755 7:157542861-157542883 TGAGGCTCACAGCACCCCTCCGG - Intronic
1035361490 7:158316564-158316586 TGCGGGCCACTGCAGCCTCCTGG + Intronic
1035633678 8:1127485-1127507 TGGGAGCCACAGCACCCTCCGGG - Intergenic
1036805849 8:11832755-11832777 TGAGGATCACAGCATCATCCTGG - Intronic
1041358195 8:57022379-57022401 GGGGGGTCAGCGCCCCCTCCCGG + Intergenic
1046009827 8:108532817-108532839 TGTGAGTCACTGCACCCGCCTGG + Intergenic
1048356932 8:133661463-133661485 TGGGGCTGACATGACCCTCCTGG + Intergenic
1048470277 8:134698711-134698733 TCCAGGGCACAGCACCCTCCTGG + Intronic
1049022930 8:139970265-139970287 TGGGCGTCACAGCCCTCTGCTGG + Intronic
1049365032 8:142232969-142232991 TGGGGCTCACTGCAGCCCCCTGG + Intronic
1049368721 8:142253399-142253421 CGGGGGTGACTGCACCCTCAGGG - Intronic
1049693248 8:143971917-143971939 AGAGGGTCCCAGCAACCTCCAGG + Intronic
1049782318 8:144434670-144434692 TGCAGGACACAGCACCCACCAGG + Intronic
1049782502 8:144435343-144435365 TGGGGGCCACAGGATCCTCCTGG + Intronic
1057198195 9:93126708-93126730 TGGGGGTCACCGGGCCCTGCAGG + Intronic
1060221823 9:121768193-121768215 TGGGGGACACAGAACATTCCAGG + Intronic
1060730423 9:126033588-126033610 TGGGGTTCAGAACACCCTCCAGG + Intergenic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1061163472 9:128909446-128909468 TGGGGTTTACAGAACCATCCAGG + Intronic
1061249210 9:129416668-129416690 GGTGGGTCACAGCACCTGCCTGG + Intergenic
1061822407 9:133235858-133235880 TGAGGGTAACAGCAACCTCATGG - Intergenic
1061992384 9:134166465-134166487 GGGAGGCCACAGCACCCTCTCGG + Intergenic
1062375808 9:136261424-136261446 TGGGTGTCAGCCCACCCTCCTGG - Intergenic
1062738832 9:138155028-138155050 TACGGGACACAGCAGCCTCCTGG - Intergenic
1186885595 X:13910123-13910145 GGGGAGCCACACCACCCTCCAGG - Intronic
1189755602 X:44268509-44268531 TGGAGGTCACAGGACACCCCAGG - Intronic
1192107140 X:68327029-68327051 TGGGGGGAACAGCCCCCGCCCGG + Intronic
1195079741 X:101359395-101359417 TGGAGGTTACAGCACCCTCCAGG + Intronic
1196045109 X:111248708-111248730 TGGAAGTCCCAGCACGCTCCTGG + Exonic
1200155916 X:153974882-153974904 TGGGGCCCACCGCATCCTCCTGG - Intronic
1200958592 Y:8974402-8974424 AGTGGGTAACATCACCCTCCTGG + Intergenic