ID: 1122891274

View in Genome Browser
Species Human (GRCh38)
Location 14:104733320-104733342
Sequence AGCCCTGAAGCCCCTTCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122891274_1122891280 25 Left 1122891274 14:104733320-104733342 CCCTGCGAAGGGGCTTCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1122891280 14:104733368-104733390 TGTGAAGTTACGTCCCAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1122891274_1122891279 24 Left 1122891274 14:104733320-104733342 CCCTGCGAAGGGGCTTCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1122891279 14:104733367-104733389 GTGTGAAGTTACGTCCCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1122891274_1122891278 21 Left 1122891274 14:104733320-104733342 CCCTGCGAAGGGGCTTCAGGGCT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1122891278 14:104733364-104733386 AGTGTGTGAAGTTACGTCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122891274 Original CRISPR AGCCCTGAAGCCCCTTCGCA GGG (reversed) Intronic
901228812 1:7630683-7630705 GGCCCTGCAGCACCTTCCCATGG - Intronic
902720105 1:18298372-18298394 TGTCCTGAAGCCCCTCCCCATGG + Intronic
903642339 1:24868536-24868558 AGCTGTGAAGCCCCTGCGCCGGG - Intergenic
904613766 1:31738993-31739015 AACCCTGAAGCCGCTTTGGATGG + Intronic
906944826 1:50286768-50286790 AGCCCTGGAGGCCTTTAGCAGGG + Intergenic
907596665 1:55726682-55726704 TGCTCTGAAGCCACTTGGCAAGG - Intergenic
907753667 1:57288390-57288412 AGCCCTGAACCCCAGTGGCATGG + Intronic
916442583 1:164842116-164842138 AGCCCTGCAGCCGCTGCTCAGGG + Intronic
917214139 1:172660425-172660447 AGGCCTGGAGCCACTTCTCAGGG - Intronic
922307136 1:224353800-224353822 GGCCCTGTAGACCCTTGGCAAGG - Intergenic
922594659 1:226804412-226804434 CACCCTGGAGCCCCTTCCCAAGG - Intergenic
922776226 1:228215309-228215331 AGCCCTGGAGCCCCGTCCCCTGG - Intronic
1063309037 10:4935645-4935667 AGCCCTGTAGGCCATTTGCAAGG + Intronic
1063841370 10:10075747-10075769 AGCCCTGAATCTCCTACCCAAGG - Intergenic
1065966692 10:30776279-30776301 AGCCATGAAGACCATTTGCAGGG - Intergenic
1066694996 10:38069445-38069467 AGCCCTGAACCCACTTGCCAGGG + Intergenic
1069961931 10:72084255-72084277 AGCCCTCCAGCCCCCTGGCAAGG + Intronic
1076109435 10:127849537-127849559 AGCCCTCGCGCCCCTTCCCAGGG + Intergenic
1076583973 10:131532961-131532983 AGCCCTGACTCCCATTCCCAGGG + Intergenic
1076612305 10:131733916-131733938 AGCTCTGCAGCCTCTTTGCAGGG - Intergenic
1079277796 11:19057935-19057957 AGCCTTGCAGCCCCATTGCAAGG + Intronic
1080346165 11:31328165-31328187 AGCCCTGAAGGCACTTTGGATGG - Exonic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082007460 11:47427416-47427438 AGCCCTGGAGCCCCTTTAAAGGG + Intergenic
1083887493 11:65580039-65580061 AGCACTGATGCCCCTTCTCCTGG + Intronic
1089189082 11:116641292-116641314 AGCCCTGAGACCCCTTCTCTGGG - Intergenic
1089203657 11:116740855-116740877 CCACCTGAAGCCCCTTGGCATGG + Intergenic
1089320773 11:117625291-117625313 ACACCTGCAGCTCCTTCGCAGGG + Intronic
1089906831 11:122048578-122048600 AGCCCTGCAGTCACTTCCCATGG + Intergenic
1095998080 12:48106045-48106067 CGGCCGGAAACCCCTTCGCATGG - Exonic
1096263429 12:50106570-50106592 GGCCCTGAAGCCCCTTCCCTGGG - Intronic
1103400172 12:120638670-120638692 AGCCCTGAAGGCTCATTGCAGGG - Intergenic
1104597915 12:130132562-130132584 ACCCCTGAAGCCACTGGGCAAGG + Intergenic
1105277244 13:18943429-18943451 TTCCCGGAAGCCCCTGCGCAGGG - Intergenic
1118312435 14:64704038-64704060 AGCCCTCAGCCCCCTTCGCAGGG + Intergenic
1118839121 14:69497832-69497854 AGCCCTGTGGCCCCTGCTCAGGG - Intronic
1119966596 14:78923151-78923173 AGCCCACAAGCACCTTCTCATGG + Intronic
1122721681 14:103725854-103725876 AGGCCTGAAGCCCCATGGCAAGG - Intronic
1122891274 14:104733320-104733342 AGCCCTGAAGCCCCTTCGCAGGG - Intronic
1122938359 14:104970226-104970248 AGCCCCGGAGCCCCTTCTCCTGG - Intronic
1123048756 14:105530734-105530756 CGCCCTGAAGCCCATCTGCAAGG + Intergenic
1127394688 15:58535141-58535163 TTCCCTAAAGCCCCTACGCAGGG + Intronic
1128114961 15:65099538-65099560 AGCTATGATGGCCCTTCGCAGGG + Exonic
1128664254 15:69526774-69526796 AGCATTTAAGCCCCTTAGCAGGG - Intergenic
1130907428 15:88250538-88250560 GGCCCAAAAGCCCCCTCGCAGGG - Intronic
1141249298 16:82340253-82340275 AGACCTGTGGCCCCTTCTCAAGG - Intergenic
1141614639 16:85203258-85203280 AGCCCTGCAACAGCTTCGCAGGG + Intergenic
1142066547 16:88066091-88066113 TGCCCTGAGGCCGCCTCGCATGG - Intronic
1143025953 17:3942099-3942121 ATCCCTGGACCCCCTTCCCAGGG - Intronic
1143780408 17:9226032-9226054 AGCCCACAGGCCCCTTCTCATGG - Intronic
1145056403 17:19706577-19706599 AGCCCAGAAGCCCCCTCCCCAGG - Intronic
1145058064 17:19716092-19716114 AAGCCTGCAGCACCTTCGCAGGG - Intronic
1147138907 17:38450865-38450887 AGCCTTCAAGCCCCTCCCCAGGG + Intronic
1147144431 17:38477098-38477120 TGCCCAGAAGCTCCTTCTCAGGG - Intronic
1147466687 17:40616245-40616267 AGCCCTGATGCCCAGTCCCAGGG + Intergenic
1151561292 17:74871260-74871282 AGCGCTGAAGCCCCTTGTCCTGG + Intronic
1155939897 18:31792495-31792517 AGCCGTGAAGCCACATCACATGG - Intergenic
1156534851 18:37852859-37852881 AGACATGAGGCCCCTTCACAAGG - Intergenic
1157319075 18:46620390-46620412 AGCCCTGCTGCCCCTTCCAATGG - Intronic
1157776280 18:50399209-50399231 TGCAGTCAAGCCCCTTCGCAGGG + Intergenic
1160718887 19:589125-589147 AGCCCACTAGCGCCTTCGCACGG - Intergenic
1160968857 19:1758623-1758645 AGCCCCCAAGCCCATTCCCATGG + Intronic
1161580422 19:5077742-5077764 ACCCCTGCAGCCCCTGCGGAGGG - Intronic
1162528690 19:11222848-11222870 AGCCCTGCTGACCCTGCGCATGG - Exonic
1163698235 19:18774672-18774694 AACCCGAAAGCCCCTTCCCAAGG - Intronic
1163727046 19:18928779-18928801 GGCCCTGAAGCCCCTTCTCTGGG + Intronic
1165060102 19:33201007-33201029 AGAGCTGAAGCCCCTTCCCCTGG - Intronic
1166100440 19:40568352-40568374 AGCCCTGAAGCCCTTTCACTGGG - Intronic
1167101520 19:47406970-47406992 ACCTCTGAACCCCCTTCGCAGGG - Exonic
925006501 2:447181-447203 AGCCCTGAAGGACGTTCACAGGG - Intergenic
927497716 2:23562066-23562088 ATCCATGAAGCCCCTTCTCTGGG - Intronic
929580438 2:43078838-43078860 AGCCCTGAAGCTCCTAAGGAGGG + Intergenic
930900795 2:56505585-56505607 AGCTCTGAAGCCCTTGGGCAAGG - Intergenic
932749288 2:74361251-74361273 AGCCCTGAGGCCCCTCAGGAAGG + Exonic
935225347 2:101047663-101047685 AGGCCTGCAGCCCCATCACAGGG + Intronic
936068809 2:109351757-109351779 AGCCCTGTGGCTCCTTCACATGG - Intronic
936525922 2:113241652-113241674 ACCCCGAAAGCACCTTCGCACGG - Exonic
937319003 2:120949554-120949576 CTCCCTGAAGCCCCTTCTCTTGG - Intronic
939564950 2:143775929-143775951 GGCCCTGAACCCCCTGTGCATGG + Intergenic
946382384 2:219358125-219358147 AGTCCTGAAGTCCCTCCTCACGG - Intergenic
1170996065 20:21360206-21360228 AGGCCTGATGCACCTTGGCAGGG + Intronic
1171196927 20:23207099-23207121 TGACCTGAAGCCCCATTGCATGG + Intergenic
1174177853 20:48656405-48656427 AGCCCTGGAGGCCCCTGGCAAGG - Intronic
1176680992 21:9819176-9819198 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1178778865 21:35580263-35580285 ATCCCAGAAGCCCCTTGTCATGG - Intronic
1178820700 21:35972567-35972589 AGCCCTGCTGCCCCCTCCCAGGG + Intronic
1179505365 21:41836307-41836329 ATCTCTGCAGCTCCTTCGCATGG - Intronic
1179991233 21:44949234-44949256 AGCCCTGGCTCCCCCTCGCACGG + Intronic
1181141180 22:20806068-20806090 ATCCCTGATGCCCCTTCTTAGGG + Intronic
1181329134 22:22075427-22075449 AGCACTGAAGCCACTGCTCAGGG - Intergenic
1182379976 22:29880051-29880073 AGCCATTAAGCCCCCCCGCAGGG - Intergenic
1183283059 22:36943162-36943184 ACCCCTGAATCCCCTTTCCACGG - Intergenic
1183665936 22:39245663-39245685 AGCCCTGCAGCATCTTCGCAGGG + Intergenic
1184664950 22:45983405-45983427 AGTCCAGAAGCCCCTTGCCAGGG - Intergenic
950438890 3:12995802-12995824 AGCCCACAAGCCCATTCCCAGGG - Intronic
950556102 3:13696919-13696941 AGCCCTGAAGCCACTTGCCCAGG - Intergenic
951991474 3:28679967-28679989 AGCCTTGAAGACCCTTCCTATGG - Intergenic
952752904 3:36839944-36839966 AGTCCTGAAGTCCTTTAGCAGGG + Intronic
954685846 3:52369754-52369776 AGCCCTGCAGCCCTTTCTCCAGG + Intronic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
955316441 3:57943208-57943230 AGCCCTGAAGGCACTTGGCATGG - Intergenic
956888475 3:73585493-73585515 AGCCATGAAGACCTTTCTCAAGG + Intronic
962290555 3:134133260-134133282 AGCCCTGAAATCCCTTCCCATGG + Intronic
968232327 3:197011268-197011290 AGCCCTGAAGCCTCCTCCCCAGG - Intronic
968558447 4:1262463-1262485 CGCCCTGAAGCCAATCCGCATGG - Intergenic
968727593 4:2255553-2255575 AGCCATGAAGCCCCTCAGCCCGG + Intronic
969451436 4:7276167-7276189 AGCCCCCAAGCCCCTTCCCAGGG - Intronic
970358649 4:15283594-15283616 AGCCATGAAGTCCTTTCCCATGG - Intergenic
975619328 4:76280367-76280389 AGCCATGAAGCCCCTCAGCAGGG - Intronic
984839898 4:184058619-184058641 AGCTCTGCTGCCCCTTGGCAAGG - Intergenic
985788340 5:1911601-1911623 AGCCCTGAGCCCACTTTGCAAGG + Intergenic
985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG + Intergenic
995780209 5:115767371-115767393 AGCCCTGAAGTCCCTCTCCATGG - Intergenic
996874471 5:128226047-128226069 AGCCCTGGAGCTCCCTAGCAAGG + Intergenic
1005255431 6:23997711-23997733 ACCCCTGAAGCCCCTGCTCCTGG - Intergenic
1005498805 6:26412297-26412319 AGGCCTGAAGACTCTTCTCAGGG - Intronic
1006136747 6:31900524-31900546 AGCACTGTAGCCCCACCGCAGGG - Exonic
1006920408 6:37624203-37624225 AGCCCTGAAGCCTGTTCCCATGG + Intergenic
1012298635 6:97556159-97556181 AGCCCTGAACTCCCTTCACTTGG - Intergenic
1018053211 6:160029708-160029730 AGCCCAGAAACGCGTTCGCATGG - Intronic
1019287326 7:230218-230240 AGCCCTGCATCCCCTTCCCTTGG - Intronic
1019538544 7:1541172-1541194 AGCGCAGAAGCCCCTGCCCACGG + Exonic
1030800633 7:113846282-113846304 TGCCCTAAAGCCCCTTCTCCTGG - Intergenic
1033510185 7:142052924-142052946 ACCCGTGAACCCCCTTCGCCTGG + Exonic
1033512983 7:142078948-142078970 ACCCGTGAACCCCCTTCGCCTGG + Intronic
1035263349 7:157675294-157675316 AGCCCTGAAGCCCCTTGGGCTGG + Intronic
1036205052 8:6799352-6799374 AGCCCAGTATCCCCTTCCCACGG - Intergenic
1036812952 8:11880179-11880201 GTCCCTGAAGCCCCTTCAGAGGG - Intergenic
1044309718 8:90679687-90679709 AGCCCTTAAGCCCCTATGCTTGG + Intronic
1047754963 8:127911437-127911459 GGCCCTGAAGAGCCTTTGCAAGG - Intergenic
1047778432 8:128092345-128092367 AGGCCTGAGGCCCCTGCCCAGGG - Intergenic
1049206440 8:141365798-141365820 GGCCCTGACGCCCCTCCTCAGGG + Intronic
1049276367 8:141722025-141722047 AGCCCTGAAGCAGCTTCTGAGGG + Intergenic
1049344380 8:142130577-142130599 AGCCCTGCAGTCCCATCCCAGGG + Intergenic
1049534041 8:143169796-143169818 ATCCCTGCAGCCCCTTTCCAGGG - Intergenic
1057293644 9:93822937-93822959 AGCCCTGGATCCCATTCCCAAGG + Intergenic
1057696285 9:97324982-97325004 AGCCCTTAAGTCCCTTCTCTGGG + Intronic
1058868232 9:109180769-109180791 ATCCCTGAAGCTCCTTCCGAAGG - Intronic
1059391758 9:114003693-114003715 AACCCTGAAGCCCCTTCCCCAGG - Intronic
1060845793 9:126836769-126836791 TGCCTTGAAGCCCTTTCCCATGG - Exonic
1061463062 9:130755742-130755764 AGCCCTGAAGCTCCTTTTCCTGG + Intronic
1061561414 9:131406268-131406290 AGCCCTGATGCACCTGCCCATGG - Intronic
1061579499 9:131528487-131528509 AGCTCTGAAGCACCTTCTGAGGG + Intronic
1061828517 9:133275807-133275829 GGCCCTGAGGCCTCTTCGCGCGG + Intergenic
1203664738 Un_KI270754v1:14671-14693 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1203665307 Un_KI270754v1:17487-17509 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1203666448 Un_KI270754v1:23123-23145 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1203667597 Un_KI270754v1:28762-28784 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1203669022 Un_KI270754v1:35811-35833 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1203669591 Un_KI270754v1:38627-38649 AGCCCTGAAGCAACTTCGGCTGG + Intergenic
1187431438 X:19228740-19228762 ATCCCTGTGGCCCCTTCACAGGG - Intergenic
1190318312 X:49165094-49165116 AGCCCTGAAGCCCCTTCCACTGG + Intronic
1198493283 X:137165333-137165355 AGCCCTGAAGCCCATGAGCAAGG + Intergenic