ID: 1122891987

View in Genome Browser
Species Human (GRCh38)
Location 14:104736249-104736271
Sequence TAGGGGCTCCTGCGACATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122891987_1122891998 9 Left 1122891987 14:104736249-104736271 CCGCCATGTCGCAGGAGCCCCTA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1122891998 14:104736281-104736303 GACTGGGCAGTAGCGCTGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 120
1122891987_1122892000 19 Left 1122891987 14:104736249-104736271 CCGCCATGTCGCAGGAGCCCCTA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1122892000 14:104736291-104736313 TAGCGCTGGCTGGCCGCTCCGGG 0: 1
1: 0
2: 1
3: 7
4: 71
1122891987_1122891997 5 Left 1122891987 14:104736249-104736271 CCGCCATGTCGCAGGAGCCCCTA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1122891997 14:104736277-104736299 GGCAGACTGGGCAGTAGCGCTGG 0: 1
1: 0
2: 0
3: 12
4: 130
1122891987_1122891999 18 Left 1122891987 14:104736249-104736271 CCGCCATGTCGCAGGAGCCCCTA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1122891999 14:104736290-104736312 GTAGCGCTGGCTGGCCGCTCCGG 0: 1
1: 0
2: 0
3: 4
4: 86
1122891987_1122891991 -7 Left 1122891987 14:104736249-104736271 CCGCCATGTCGCAGGAGCCCCTA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1122891991 14:104736265-104736287 GCCCCTAGCCCTGGCAGACTGGG 0: 1
1: 0
2: 2
3: 14
4: 178
1122891987_1122891990 -8 Left 1122891987 14:104736249-104736271 CCGCCATGTCGCAGGAGCCCCTA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1122891990 14:104736264-104736286 AGCCCCTAGCCCTGGCAGACTGG 0: 1
1: 0
2: 0
3: 26
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122891987 Original CRISPR TAGGGGCTCCTGCGACATGG CGG (reversed) Intronic
900163651 1:1236221-1236243 CAGGGGCTCCTGCAACCTTGTGG + Intergenic
900501214 1:3005556-3005578 CAGGGGCACCTGGGACAAGGTGG + Intergenic
901878096 1:12178580-12178602 TAGGGGCTCCTGTGACAACCCGG - Intronic
905569466 1:38991884-38991906 GAGGGGCTTCAGCGACAGGGAGG - Intronic
912499557 1:110113008-110113030 TCAGAGCTCCTGTGACATGGAGG + Exonic
915028923 1:152859338-152859360 AAGGGGCTGCTGTGAAATGGGGG + Intergenic
920852483 1:209637854-209637876 GAGGGGCTCCTGGGCCATGTGGG - Intronic
922902261 1:229146384-229146406 TCGGGGCTCCTTCAAGATGGTGG - Intergenic
1065497413 10:26343482-26343504 CATGGGCTCCTGAGAGATGGAGG + Intergenic
1073057131 10:100710072-100710094 GAGGGGCTCCTGGGGGATGGGGG - Intergenic
1076177576 10:128379917-128379939 TAGGGGCTCCTGCGAGGTTCTGG - Intergenic
1076759545 10:132595140-132595162 GAGGGGCTCCTGTGACGTGCTGG + Intronic
1111253786 13:85639662-85639684 TGTGGGCTCCTGTGACATGGTGG + Intergenic
1122891987 14:104736249-104736271 TAGGGGCTCCTGCGACATGGCGG - Intronic
1123418245 15:20108056-20108078 TGGGGGTTCCTGCTGCATGGAGG + Intergenic
1123527463 15:21114578-21114600 TGGGGGTTCCTGCTGCATGGAGG + Intergenic
1125382385 15:39100648-39100670 TGAGGGATCCTGCGACCTGGTGG + Intergenic
1125519050 15:40338213-40338235 TAGGGGCTGCTGCCACCTAGAGG + Intronic
1125683829 15:41550647-41550669 TAGGCGCTCCACCCACATGGAGG - Intergenic
1129677848 15:77642122-77642144 TAGGAGCCCCTGAGATATGGGGG - Intronic
1134054673 16:11162226-11162248 TGGGGGCTCCTGGGAAGTGGGGG + Intronic
1137564414 16:49524452-49524474 TGGGGGCTCCTGCGATGAGGGGG + Intronic
1144621699 17:16822429-16822451 GAAGGGCTCCTGCGGCATCGGGG - Intergenic
1144884721 17:18450285-18450307 GAAGGGCTCCTGCGGCATCGGGG + Intergenic
1145147506 17:20494092-20494114 GAAGGGCTCCTGCGGCATCGGGG - Intergenic
1147573685 17:41586771-41586793 GAAGGGCTCCTGCGGCATCGGGG - Exonic
1148457109 17:47816951-47816973 GACGGCCTCCTGCGCCATGGAGG + Intronic
1148789907 17:50167275-50167297 TAGGGGCTCCAAGGACTTGGTGG + Intronic
1152408814 17:80111894-80111916 CAGGGGCTCCTGGGAGGTGGGGG + Intergenic
1157557810 18:48624191-48624213 CAGGTGCTCCTGAAACATGGGGG - Intronic
1160764858 19:803041-803063 GAGGGGCTCCTGCGAGAGTGAGG + Intronic
1163572685 19:18091506-18091528 TAGGGTCTCTTGCCACATGGAGG - Intronic
1165593489 19:36991037-36991059 TACTGGCTCCTTCAACATGGAGG - Intronic
1165595721 19:37009975-37009997 TAGGGGCTCCTGCTGCAGCGCGG - Intronic
1168258274 19:55179024-55179046 TGGGGGCTCCGGGAACATGGTGG + Exonic
925872612 2:8284177-8284199 TAGGGACCCCTGAGACATGCAGG - Intergenic
926685616 2:15695581-15695603 CAGGGCCTCCTGGGACATGAGGG - Intronic
930503755 2:52255976-52255998 ATGGGGCTCCTGGGCCATGGAGG + Intergenic
931867250 2:66426212-66426234 GAGTGGCTCCTGCGGCACGGCGG - Intergenic
934980579 2:98836518-98836540 CATGGGCTCCTGTGACAGGGAGG + Intronic
935980924 2:108625998-108626020 TACGGGATCATGAGACATGGTGG - Intronic
948034156 2:234844376-234844398 TAGGAGCTCATTCCACATGGGGG - Intergenic
1168889837 20:1287892-1287914 TAGTGGCTCCTGGCAGATGGAGG - Intronic
1171207597 20:23293340-23293362 TAGTGGCACCTCCCACATGGTGG + Intergenic
1172176030 20:32972480-32972502 TAGGGGCTCGTGAGACAGGCAGG - Intergenic
1174398269 20:50261161-50261183 TGGGGGCTGCTGGGACATGAAGG - Intergenic
1180593958 22:16961814-16961836 GAGGGGCTCCTGGGACAGGCAGG - Intergenic
1181308395 22:21929935-21929957 TATGGGCTTTTGCCACATGGAGG - Intronic
968585336 4:1413747-1413769 TCGTGGCTCCTCCGACAGGGTGG + Intergenic
972347561 4:38205545-38205567 CAGGGGCCCCTGTGGCATGGTGG + Intergenic
973743131 4:53937436-53937458 TAGGGGCTTCTTAGACTTGGGGG - Intronic
973808651 4:54549105-54549127 GAGGGGCTCCTGTGACAGGTGGG + Intergenic
973830541 4:54754947-54754969 TATGGGCTCCTGGGAGATAGAGG + Intergenic
975902375 4:79167936-79167958 TAGGTGCACCTGTGCCATGGTGG + Intergenic
977615156 4:99080349-99080371 TAGGGGATCCTGGGACAGGGAGG + Intronic
983288256 4:165767058-165767080 TAGAAGCTTCTTCGACATGGGGG + Intergenic
987571646 5:19670469-19670491 AAGGGGCTCCTGTGCCATGCAGG + Intronic
993498927 5:88641259-88641281 TAAGGGCTGCAGCGACATAGTGG - Intergenic
994736444 5:103562511-103562533 CAGGGGCTCCCGCGACAGGGCGG - Intronic
1011241015 6:85271469-85271491 TAGTGGCTCCTGGGGGATGGGGG - Intergenic
1013599096 6:111687546-111687568 TCAGGGCTCCTTCCACATGGAGG - Intronic
1017103084 6:150865683-150865705 TAGGGGCCCCTGGGACGAGGAGG + Exonic
1017801121 6:157897404-157897426 TAGGGGCACCTGGGGCAGGGGGG - Intronic
1023984635 7:45087722-45087744 CAGGGGGTCCTGAGACAAGGGGG + Intronic
1026159451 7:67855958-67855980 TAGGGGATCCTGAGACCAGGAGG - Intergenic
1026948423 7:74331371-74331393 CAGGGCCTCCTGAGATATGGAGG + Intronic
1034574213 7:151983573-151983595 TAGGGGCTCTTGGTATATGGTGG + Intronic
1035584404 8:760879-760901 TAGGGTCTCCCGCAGCATGGTGG - Intergenic
1041517421 8:58715800-58715822 CAGGGGCTCCTGCCTCATGGAGG + Intergenic
1048292448 8:133191261-133191283 TACTGGGTCCTGCTACATGGGGG + Intronic
1053528485 9:38853865-38853887 TGGGGAGTCCTGCCACATGGTGG + Intergenic
1054200712 9:62078298-62078320 TGGGGAGTCCTGCCACATGGTGG + Intergenic
1054637647 9:67510065-67510087 TGGGGAGTCCTGCCACATGGTGG - Intergenic
1055719817 9:79160326-79160348 TTGGGCCTCATGGGACATGGTGG + Intergenic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1062174757 9:135155113-135155135 TAGAGGCTCCAGTGAGATGGGGG + Intergenic
1192152216 X:68719401-68719423 GAGTGGCTCCTGGGCCATGGAGG + Intronic
1197765607 X:130057694-130057716 TAGAGGCTCCTGAGCCATGCGGG + Exonic