ID: 1122893477

View in Genome Browser
Species Human (GRCh38)
Location 14:104743773-104743795
Sequence AGGTGGGTATAGAGCTAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122893473_1122893477 -10 Left 1122893473 14:104743760-104743782 CCAGACCCCTGCTAGGTGGGTAT 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG 0: 1
1: 0
2: 0
3: 5
4: 75
1122893466_1122893477 30 Left 1122893466 14:104743720-104743742 CCAGGGTTGAGAGCATCAGCCAA 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG 0: 1
1: 0
2: 0
3: 5
4: 75
1122893469_1122893477 3 Left 1122893469 14:104743747-104743769 CCTGGAGAATTAACCAGACCCCT 0: 1
1: 0
2: 0
3: 19
4: 114
Right 1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG 0: 1
1: 0
2: 0
3: 5
4: 75
1122893468_1122893477 11 Left 1122893468 14:104743739-104743761 CCAAAATTCCTGGAGAATTAACC 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122893477 Original CRISPR AGGTGGGTATAGAGCTAATC CGG Intronic
900842689 1:5067387-5067409 TGGTGTTTCTAGAGCTAATCGGG - Intergenic
903191893 1:21661357-21661379 AGGAGACTATAGAGCTGATCAGG - Intronic
905134883 1:35791093-35791115 AGATGGGTAGATAGATAATCTGG + Intergenic
908202613 1:61813000-61813022 AGGAGGCTAAAAAGCTAATCAGG - Intronic
912344173 1:108948951-108948973 AGGTGGGTATAGATCTTATTGGG + Intronic
917388865 1:174510160-174510182 AGGAGGCTAAAGAGCTAAACTGG - Intronic
917680767 1:177364779-177364801 AGGTGGGTGAAGACCTAAGCAGG + Intergenic
918158467 1:181873448-181873470 AGGAGGTTATTAAGCTAATCAGG + Intergenic
1071040441 10:81302531-81302553 ACGTAGGAATACAGCTAATCAGG + Intergenic
1078049452 11:7949273-7949295 AGGTGTGATTAGAGCCAATCTGG + Intergenic
1081677225 11:44977401-44977423 AGGTGAGTATAAATATAATCAGG + Intergenic
1086191394 11:84083606-84083628 AGGTGGTTATAAAGCAAGTCTGG + Intronic
1086395509 11:86411381-86411403 GGGTGGGAAAAGAGCTAAACTGG - Intronic
1087395308 11:97589407-97589429 AGGTGGGGACAGGGCTAAGCGGG - Intergenic
1092335667 12:7630731-7630753 ACGTGGGTATACAGCTAATGAGG + Intergenic
1093856909 12:24115458-24115480 AGGTTGCTATAGAGCTTATCGGG - Intergenic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1109309440 13:60674816-60674838 AGGTTAGAATAGAGCAAATCAGG + Intergenic
1110881671 13:80578836-80578858 AGGTTGTTATTAAGCTAATCAGG + Intergenic
1113350805 13:109527349-109527371 AAGTGGGTATAAATATAATCAGG - Intergenic
1122893477 14:104743773-104743795 AGGTGGGTATAGAGCTAATCCGG + Intronic
1126245569 15:46500726-46500748 ACCTAGGTATACAGCTAATCAGG + Intergenic
1128238846 15:66085851-66085873 AGGAGGTTATTAAGCTAATCAGG + Intronic
1128415133 15:67437582-67437604 AGGAGGTTATTAAGCTAATCAGG + Intronic
1129311122 15:74710075-74710097 AGGTGGGTATACTGCTGATTGGG + Intergenic
1132368866 15:101278800-101278822 AGGCGGATTTAAAGCTAATCTGG - Intergenic
1134914358 16:18057483-18057505 AGGTGGGAAAAGTGCTGATCAGG + Intergenic
1139141591 16:64269808-64269830 AGGTGGGGAGACAGATAATCTGG - Intergenic
1144776234 17:17786151-17786173 AGGTGGGTATGGAGACAAACTGG - Intronic
1153085597 18:1282628-1282650 ACCTAGGTATACAGCTAATCAGG + Intergenic
1153389192 18:4534866-4534888 AGGTGGGTAGAGCACCAATCAGG - Intergenic
1156919785 18:42507523-42507545 AGATGGATATAGAGATAATAGGG + Intergenic
1164402264 19:27910445-27910467 AGGTGGGTATATAGCTGTTGAGG + Intergenic
1165267226 19:34670092-34670114 AGTTGGATAAAGAGGTAATCGGG + Intronic
1166663744 19:44664560-44664582 AGGTGGGTGTAGAACAACTCAGG - Intronic
925100744 2:1243329-1243351 AGGTGGGTGTACAGCTCATGGGG + Intronic
926783562 2:16498100-16498122 AGAAGGGTAAAGAGCTGATCTGG + Intergenic
927278225 2:21279725-21279747 AGCAGGGTACAGAGCTGATCTGG - Intergenic
928990120 2:37224359-37224381 AGGTGTTAATAGAGCTAATCTGG - Intronic
947304778 2:228732315-228732337 AGGGGGCTAGAGAGCTGATCTGG - Intergenic
947401818 2:229738612-229738634 AGGAGGGAATAGAGCTATACTGG + Intergenic
1170133647 20:13050114-13050136 AGGAGGTTATTAAGCTAATCAGG + Intronic
1177724611 21:24950962-24950984 AGGTGGGGAAAGAGATAAGCTGG + Intergenic
1182612618 22:31561498-31561520 GGGTGGGGACAGAGGTAATCTGG + Intronic
1183239440 22:36646016-36646038 AGTTGGGGATAGACATAATCTGG + Intronic
954529994 3:51309968-51309990 AAGTGGGTATAGAGCTGCTTTGG + Intronic
963665888 3:148185333-148185355 TGATGGTTATAAAGCTAATCTGG - Intergenic
966550968 3:181203634-181203656 TGGTGGGTATAAAACTTATCTGG - Intergenic
971589454 4:28448581-28448603 AGGTGGCTATAAAGCTGATAAGG + Intergenic
972419680 4:38875389-38875411 ACGTAGGAATACAGCTAATCAGG - Intronic
972591256 4:40489330-40489352 AGGTGGGAATAAAGCAAATACGG + Intronic
975407315 4:74004763-74004785 AGCTCGGTATAGACCCAATCAGG - Intergenic
976545035 4:86325432-86325454 AGCTGGCTTTAGAGCTAAACTGG - Intronic
977869958 4:102079799-102079821 AAGTGGGTATTGACCTAATTAGG + Intergenic
986584031 5:9295619-9295641 AGGTGGTCTGAGAGCTAATCTGG + Intronic
987368078 5:17167805-17167827 ACCTGGCTATAGAGCTAAACAGG - Intronic
996513201 5:124340786-124340808 ATGTGGGTTTGGAGGTAATCAGG - Intergenic
997292064 5:132744199-132744221 AGGAGGGAATAGAGCTATACGGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1004612311 6:17254901-17254923 AGTTGGATATGGAGGTAATCTGG - Intergenic
1006750610 6:36374459-36374481 CTGTGGGTAGAGAGCCAATCTGG + Intronic
1008807245 6:55444958-55444980 ATCTGTGTCTAGAGCTAATCTGG - Intronic
1010029828 6:71262121-71262143 AGTTGGGTAGAGAGCTCATGGGG - Intergenic
1011501072 6:87990696-87990718 AGGGGGGTATTGTGGTAATCTGG + Intergenic
1012033920 6:94107651-94107673 ATGTGGGTTTAGTGCTAATGTGG + Intergenic
1015389291 6:132663085-132663107 ATGTGAGTATTCAGCTAATCTGG - Intergenic
1031753820 7:125612757-125612779 AGTTGGGTAGAGAACTAAGCAGG + Intergenic
1033864404 7:145671302-145671324 TGGTGGGTATTTAGCCAATCTGG + Intergenic
1037637027 8:20709339-20709361 AGTTGGGTATAGGGCTCATTTGG - Intergenic
1039762009 8:40587017-40587039 AGGAGGGTAAAGAGCTATCCAGG + Intronic
1048112718 8:131486066-131486088 AGATGGGGACAGAGCTAATGTGG - Intergenic
1048533521 8:135272158-135272180 AGCAGGGTTTAGAGCTAACCAGG - Intergenic
1055172530 9:73276441-73276463 AGGTGGGGATAGAGTTAAGCTGG + Intergenic
1056521247 9:87403603-87403625 ATGAAGGTATAGAGATAATCTGG + Intergenic
1059858734 9:118432817-118432839 AGCTGGGTATAGAACTGAACTGG + Intergenic
1060693244 9:125683634-125683656 AGCTGGCTATATAGCTCATCTGG - Intronic
1186582363 X:10833870-10833892 TGGTGTGTATAGAGTTAACCAGG - Intergenic
1188855367 X:35187931-35187953 ACGTAGGAATACAGCTAATCGGG - Intergenic
1189827626 X:44935958-44935980 AGGTGGTTGCAGAGCTACTCTGG + Intronic
1194034915 X:88858561-88858583 AGCTAGGTATACAGCTAAACAGG - Intergenic
1199558123 X:149131499-149131521 AGGTGGGGATAGATCTGTTCAGG + Intergenic