ID: 1122893530

View in Genome Browser
Species Human (GRCh38)
Location 14:104744036-104744058
Sequence CTCCCTTCCTGGTCCATCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 236}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122893530_1122893538 5 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893538 14:104744064-104744086 CATCATTGGCATCAGTGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 136
1122893530_1122893542 14 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893542 14:104744073-104744095 CATCAGTGGGTGGGTGGGCAGGG 0: 1
1: 0
2: 4
3: 66
4: 422
1122893530_1122893537 4 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893537 14:104744063-104744085 CCATCATTGGCATCAGTGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 124
1122893530_1122893541 13 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893541 14:104744072-104744094 GCATCAGTGGGTGGGTGGGCAGG 0: 1
1: 0
2: 7
3: 66
4: 739
1122893530_1122893540 9 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893540 14:104744068-104744090 ATTGGCATCAGTGGGTGGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 222
1122893530_1122893539 8 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893539 14:104744067-104744089 CATTGGCATCAGTGGGTGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 203
1122893530_1122893533 -9 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893533 14:104744050-104744072 GGAAGGGAGGCTGCCATCATTGG 0: 1
1: 0
2: 2
3: 21
4: 210
1122893530_1122893535 1 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893535 14:104744060-104744082 CTGCCATCATTGGCATCAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 142
1122893530_1122893544 24 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893544 14:104744083-104744105 TGGGTGGGCAGGGACCAGGAAGG 0: 1
1: 1
2: 7
3: 93
4: 709
1122893530_1122893543 20 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893543 14:104744079-104744101 TGGGTGGGTGGGCAGGGACCAGG 0: 1
1: 0
2: 14
3: 125
4: 1189
1122893530_1122893534 0 Left 1122893530 14:104744036-104744058 CCGAAGATGGACCAGGAAGGGAG 0: 1
1: 0
2: 3
3: 20
4: 236
Right 1122893534 14:104744059-104744081 GCTGCCATCATTGGCATCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122893530 Original CRISPR CTCCCTTCCTGGTCCATCTT CGG (reversed) Intronic