ID: 1122895347

View in Genome Browser
Species Human (GRCh38)
Location 14:104753851-104753873
Sequence GCAGGAGGAGTCGCCACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 229}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122895335_1122895347 9 Left 1122895335 14:104753819-104753841 CCGGGAGCTCCCCAGCCTAGTTG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895339_1122895347 0 Left 1122895339 14:104753828-104753850 CCCCAGCCTAGTTGGGGAGACCA 0: 1
1: 0
2: 1
3: 18
4: 184
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895334_1122895347 10 Left 1122895334 14:104753818-104753840 CCCGGGAGCTCCCCAGCCTAGTT 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895332_1122895347 17 Left 1122895332 14:104753811-104753833 CCCGTCTCCCGGGAGCTCCCCAG 0: 1
1: 0
2: 4
3: 25
4: 273
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895340_1122895347 -1 Left 1122895340 14:104753829-104753851 CCCAGCCTAGTTGGGGAGACCAG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895341_1122895347 -2 Left 1122895341 14:104753830-104753852 CCAGCCTAGTTGGGGAGACCAGC 0: 1
1: 0
2: 3
3: 15
4: 106
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895333_1122895347 16 Left 1122895333 14:104753812-104753834 CCGTCTCCCGGGAGCTCCCCAGC 0: 1
1: 1
2: 2
3: 37
4: 326
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895331_1122895347 18 Left 1122895331 14:104753810-104753832 CCCCGTCTCCCGGGAGCTCCCCA 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229
1122895343_1122895347 -6 Left 1122895343 14:104753834-104753856 CCTAGTTGGGGAGACCAGCAGGA 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG 0: 1
1: 0
2: 2
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122895347 Original CRISPR GCAGGAGGAGTCGCCACAGG TGG Intronic
900285667 1:1899168-1899190 AAAGGAGGAGGCGCCACATGGGG - Intergenic
900335478 1:2160941-2160963 GCAGGAGGAGGCGCCGCCGTCGG + Intronic
900639648 1:3682522-3682544 GCAGGAGGGGTGGCCCCGGGAGG + Intronic
900900446 1:5512372-5512394 GCAGGATGAGTGACCACAGGAGG - Intergenic
901031168 1:6307789-6307811 GCAGAAGGAACAGCCACAGGTGG + Intronic
901031319 1:6308536-6308558 GCAGAAGGAACAGCCACAGGCGG + Intronic
901115517 1:6840766-6840788 GCAGGAGGAGCCAGCACAGGAGG + Intronic
901117227 1:6856948-6856970 GCAGGAGAAGAGGCCACAGCAGG + Intronic
901822250 1:11837630-11837652 AGGGGAGGAGTCGCCACAGCCGG + Intronic
902456021 1:16534680-16534702 GCAGGTGGAGTAGGCACAGACGG - Intergenic
902496145 1:16873231-16873253 GCAGGTGGAGTAGGCACAGATGG + Intronic
903672321 1:25043808-25043830 GCAGGAGGAGTCGGAGCTGGAGG - Intergenic
903747675 1:25599256-25599278 GCTGGAGGAGTCAGCAAAGGTGG + Intergenic
904310823 1:29628492-29628514 GCATGAGCAGAGGCCACAGGAGG + Intergenic
904399579 1:30247450-30247472 GCAGGAGGGGTCGAGATAGGTGG - Intergenic
905458161 1:38102753-38102775 GCTGGAGGAGGGGCAACAGGAGG + Intergenic
906733457 1:48102779-48102801 GCAGCAGGAAGAGCCACAGGAGG - Intergenic
912263373 1:108131038-108131060 GCAGATGCAGTGGCCACAGGAGG - Intergenic
912625619 1:111203216-111203238 GCAGGAGGAATGGCAACAGGAGG + Intronic
915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG + Intronic
918999719 1:191814679-191814701 CCAGGTGGAGTAGCCACGGGTGG - Intergenic
919769031 1:201145369-201145391 GCAGGAGGGGCTGCCTCAGGTGG + Intronic
919863315 1:201758021-201758043 GCCGGATGAGTCCCCACAAGTGG - Intronic
922810894 1:228414965-228414987 GCAGAAGTTGTGGCCACAGGTGG + Exonic
924419568 1:243895730-243895752 GCAGTGGGAGAAGCCACAGGAGG + Intergenic
1063658201 10:8012530-8012552 GCAGCAGGACTGGCCACACGTGG + Intronic
1067031338 10:42880151-42880173 GCGGGAGGAGCAGCCACAGCGGG + Intergenic
1068783469 10:60944841-60944863 GCGGGAGGGGTCCCCCCAGGGGG + Intronic
1071666372 10:87562750-87562772 GCAGGAAGAGTCGTCACAGCGGG - Intergenic
1072430129 10:95363872-95363894 GAAGGAGGAGGAGTCACAGGTGG - Intronic
1072935608 10:99710123-99710145 GAAGGAGGAGTGGCCACCAGAGG - Intronic
1075423963 10:122327463-122327485 GTGGGAGCAGTAGCCACAGGTGG - Intronic
1077284804 11:1760889-1760911 GAAGGAGTAGTGGGCACAGGAGG + Intronic
1077557210 11:3231467-3231489 GTAGGAAGGGTCGCCACAGTTGG + Intronic
1078546349 11:12249730-12249752 GCAGGCTGTGTGGCCACAGGTGG + Intronic
1079172051 11:18105828-18105850 GCAGGAGGATTCGCCAGAGGCGG + Intronic
1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG + Intronic
1083940894 11:65895075-65895097 CCAGGGGGAGTCACCACAGCTGG + Intronic
1084161587 11:67353260-67353282 GCAGGAGGAGTGGACACGGAGGG - Intronic
1084216378 11:67648928-67648950 CCAGGAGGAGTGGCCCCTGGAGG - Intronic
1084564097 11:69919897-69919919 GAAGGAGGACTCACCCCAGGAGG - Intergenic
1084564116 11:69919974-69919996 GCAGGAGGACTAACCCCAGGAGG - Intergenic
1084665028 11:70571719-70571741 ACTGGAGGAGTCGGCAAAGGAGG + Intronic
1085024556 11:73229041-73229063 GCAGGAGGCCTGACCACAGGAGG - Intronic
1088770126 11:113026449-113026471 ACAGGAGGAGTGGTCACAGAGGG + Intronic
1090651488 11:128810472-128810494 CCAGGAGGAATTGCCACAGCTGG - Exonic
1091174329 11:133545985-133546007 GAAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174349 11:133546056-133546078 GGAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174384 11:133546180-133546202 GGAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174421 11:133546302-133546324 GAAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174431 11:133546338-133546360 GGAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174447 11:133546391-133546413 GAAGGAGGAGGCTGCACAGGGGG - Intergenic
1091451595 12:575594-575616 GCAGAAGGAGCCGTCTCAGGAGG - Intronic
1092027817 12:5257875-5257897 GCAGGAGTAGGTGACACAGGAGG + Intergenic
1092998957 12:13977815-13977837 CAAGGAGGAATCGCCACAGGTGG - Intronic
1096153603 12:49329923-49329945 CCAGAAGGAGTGGCCACCGGTGG - Exonic
1096237538 12:49939931-49939953 GCAGGAGGAGGAGCCCCAGGGGG - Intergenic
1096678734 12:53241085-53241107 GCAATAGCAGTGGCCACAGGAGG - Intergenic
1099093391 12:78341051-78341073 GCAGGATGAGTGGGCACAGCTGG - Intergenic
1102532126 12:113554276-113554298 GCTGGAGGAGGGGCCACAGGAGG - Intergenic
1105472467 13:20705126-20705148 GCAGGAGGAGCTGCCCTAGGGGG + Intronic
1106246388 13:27953896-27953918 GCAGCCGGAGCCGCCGCAGGAGG - Intergenic
1106887751 13:34208031-34208053 GCAGGAGAAGCAGCCACAGAAGG - Intergenic
1106934820 13:34706178-34706200 CCAGGAGGAGTCGGCATGGGTGG + Intergenic
1107851312 13:44576175-44576197 GAAGGAGGAATCGCGCCAGGCGG - Exonic
1108007766 13:45969209-45969231 GCAGTGGCAGTAGCCACAGGCGG + Exonic
1109603334 13:64661077-64661099 GGAGTAGGAGGAGCCACAGGAGG + Intergenic
1111286381 13:86098683-86098705 GAATTAGGAGTTGCCACAGGTGG - Intergenic
1112502377 13:99953055-99953077 GCAGGAGGAGTGGCCAAGGAGGG + Intergenic
1113457824 13:110461480-110461502 GCAGTGGAAGTAGCCACAGGTGG - Intronic
1116773286 14:49151638-49151660 GCAGGAGGAGGCCAGACAGGAGG - Intergenic
1117978699 14:61321691-61321713 GCAGGAGGAGAAGCAAGAGGAGG + Intronic
1118869125 14:69726900-69726922 GCCGGAGGAAGCGCCACGGGCGG + Exonic
1120859455 14:89241765-89241787 GCATGAGAAGTTGCCACTGGAGG + Intronic
1121526323 14:94621822-94621844 GCAGGAGGAGTTGCTCCACGGGG - Intronic
1121553759 14:94820890-94820912 GCAGGAAGGGTGGCCAAAGGGGG + Intergenic
1121716942 14:96083146-96083168 GCAGAAGGGCTCCCCACAGGCGG - Intronic
1121720840 14:96107619-96107641 GCAGGAAGAGACGCCAGAGGTGG + Intergenic
1122162308 14:99793348-99793370 GCAGCAGCAGCCGCCACAGCAGG + Exonic
1122369749 14:101222934-101222956 GCAGGAGGACTGTCCCCAGGAGG - Intergenic
1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG + Intronic
1123476838 15:20596801-20596823 GCAGGTGGAGAGGCCCCAGGTGG + Intergenic
1123641173 15:22403563-22403585 GCAGGTGGAGAGGCCCCAGGTGG - Intergenic
1124854806 15:33377513-33377535 GCATGAGCATTCTCCACAGGTGG + Intronic
1126807186 15:52362777-52362799 GCTGGAGGAGGCGTCACTGGAGG + Intronic
1127350697 15:58149166-58149188 GCAGCAGCAGTTGTCACAGGAGG + Intronic
1128235086 15:66061482-66061504 GCAAGAGGAGGCCCCACAGCTGG + Intronic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1131065304 15:89430922-89430944 GCAGGAGTAGGCGGCAGAGGCGG + Intergenic
1132311236 15:100859453-100859475 ACAGGAGGAGAAGCCCCAGGAGG - Intergenic
1132891957 16:2208991-2209013 GCAGGTCAAGGCGCCACAGGGGG - Exonic
1136370678 16:29834100-29834122 GCAGGAGGGGTCCCCACTGCAGG + Intronic
1137003326 16:35250733-35250755 TCAGCAGGAGTAGCCACTGGGGG - Intergenic
1137617296 16:49855595-49855617 GGAGGAGGAGGCGGCAGAGGAGG - Intronic
1139850736 16:69950599-69950621 GCAGGAGGAGTCAAAGCAGGCGG - Intergenic
1139879721 16:70173511-70173533 GCAGGAGGAGTCAAAGCAGGCGG - Intronic
1140372804 16:74422037-74422059 GCAGGAGGAGTCAAAGCAGGCGG + Intergenic
1142287194 16:89176264-89176286 GCAGGAGCAGGCGGCACTGGAGG + Intronic
1142561309 17:811126-811148 GCGGGAGGAGGTGGCACAGGAGG + Intronic
1143756252 17:9069902-9069924 CCAGGAGGATGAGCCACAGGTGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147214521 17:38891355-38891377 GCAGCAGGAGTCCCCTCTGGAGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152567874 17:81108167-81108189 GCAGGAGGAGGGGTCTCAGGCGG + Intronic
1152818580 17:82423961-82423983 GCAGGAGGAGCCGGGGCAGGGGG - Intronic
1152879330 17:82806453-82806475 GCAGCAGGAGACCCCACAGGAGG - Intronic
1157128678 18:44982338-44982360 CCTGGAGCAGTCGCCTCAGGGGG + Intronic
1157764494 18:50286473-50286495 GGAGGAGGAGGAGCCACAAGGGG - Intronic
1158199646 18:54925702-54925724 GCAGTATGAGTCCCCACAGATGG - Intronic
1160303168 18:77704820-77704842 GACGGAGAAGTTGCCACAGGTGG + Intergenic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1160809919 19:1008898-1008920 GAAGGAGGAGACGGCAGAGGCGG + Exonic
1160828197 19:1090367-1090389 ACAGGAGGAGTCCCAGCAGGAGG - Intronic
1160845648 19:1164896-1164918 GGAGGAGGAGGAGGCACAGGAGG + Intronic
1160845654 19:1164917-1164939 GGAGGAGGAGGAGGCACAGGAGG + Intronic
1161377450 19:3947277-3947299 GCAGGAGGGGTCTCCTCTGGGGG - Intergenic
1161952557 19:7475946-7475968 GCAGAAGGAGCCCCCACAGATGG + Intergenic
1162494037 19:11013274-11013296 GCAGGAAGAGAGGCCTCAGGAGG - Intronic
1162585571 19:11556144-11556166 GTTGGAGGAGGCGCCATAGGAGG - Intronic
1162969292 19:14170449-14170471 GGAGAAGGTGTCCCCACAGGAGG + Intronic
1164787019 19:30941577-30941599 GCAGGAGGCGTGGCCTCAAGTGG + Intergenic
1166118139 19:40668028-40668050 GCTGGAGGAGGTGTCACAGGTGG - Exonic
1166254451 19:41592360-41592382 GCAGAGGGAGTGGCCTCAGGTGG - Intronic
1166701119 19:44882225-44882247 GCAGGCGCAGGGGCCACAGGCGG + Exonic
1166851318 19:45762895-45762917 GCAGGTGGGGTCACCCCAGGAGG + Intronic
1168203833 19:54835092-54835114 GCAGGGGGCCTGGCCACAGGAGG + Intronic
1168635233 19:57991014-57991036 GCAGGAGGCGTCTCTACATGGGG - Intronic
1202706910 1_KI270713v1_random:31036-31058 GCAGGTGGAGTAGGCACAGATGG - Intergenic
927125955 2:20012586-20012608 GCAGGAGGAGTCCCGGGAGGCGG + Exonic
927250765 2:20993198-20993220 GCAGGAGGAGCCTGCACTGGAGG + Intergenic
928702274 2:33911035-33911057 AGAGGAGGAGTGCCCACAGGTGG - Intergenic
933093096 2:78145946-78145968 TCAGGAGGAGCCTCCACAAGAGG + Intergenic
934553790 2:95277107-95277129 GCAGGTGGGATCGCCCCAGGAGG - Intronic
934783266 2:96986403-96986425 GCAGGAGCAGGCTCCCCAGGCGG + Exonic
935463015 2:103361781-103361803 GCGGGAGGAGGCGGCAGAGGAGG - Intergenic
936088308 2:109484548-109484570 GCAGGAGGTAACTCCACAGGAGG - Intronic
936525833 2:113241157-113241179 GCAGGATGAGTGGCCAAAGGTGG + Intronic
937138284 2:119574641-119574663 GCAGAAGCAGTGGCCAAAGGTGG - Intronic
937452363 2:122012212-122012234 GCAGGAGATGTGGCCACTGGTGG + Intergenic
938343400 2:130549800-130549822 GCAGGAGGATTGGCCAGAGGAGG + Exonic
938346433 2:130570922-130570944 GCAGGAGGATTGGCCAGAGGAGG - Exonic
939327251 2:140709408-140709430 GCAGGAGGAGGCGGAAGAGGAGG + Intronic
940328469 2:152450698-152450720 GCAGGAGGAGATGCCACATGGGG - Intronic
947794713 2:232887005-232887027 ACAGGAGGAGTGGCCCGAGGTGG + Intronic
948294807 2:236852785-236852807 GCAGGAGGAGGCGCCACGTGAGG - Intergenic
1169236535 20:3934204-3934226 GCAGAAGGAGACACCACAGGGGG + Intronic
1170506552 20:17031440-17031462 ACAGGAGCAGTGGCCACAGAGGG + Intergenic
1171436806 20:25130589-25130611 TCAGGTGGAGTCCCCTCAGGTGG + Intergenic
1171436811 20:25130604-25130626 TCAGGTGGAGTCCCCTCAGGTGG + Intergenic
1172533768 20:35654553-35654575 GCAGGTAGAGGTGCCACAGGTGG + Exonic
1174178491 20:48659623-48659645 GCAGGATGAGTTGCTTCAGGAGG + Intronic
1174834371 20:53842124-53842146 GCAGGAGGAGTGGGTACCGGGGG + Intergenic
1176192007 20:63815983-63816005 GCAGGTGCAGTGGGCACAGGTGG + Intronic
1176192027 20:63816063-63816085 GCAGGTGCAGTGGGCACAGGTGG + Intronic
1176259983 20:64174515-64174537 GCAGGAGGAGACGCCAGGGAGGG - Intronic
1176260114 20:64175162-64175184 GCAGGAGGAGACGCCAGGGAGGG - Intronic
1176260186 20:64175515-64175537 GCAGGAGGAGACGCCAGGGAGGG - Intronic
1176260296 20:64176059-64176081 GCAGGAGGAGACGCCAGGGAGGG - Intronic
1176260328 20:64176212-64176234 GCAGGAGGAGACGCCAGGGAGGG - Intronic
1178705882 21:34872376-34872398 GCTGGAGGAGTGGCTGCAGGTGG - Intronic
1178781470 21:35606920-35606942 GCAGGAGGAGCTGCCACAAAAGG - Intronic
1180094635 21:45550235-45550257 GCAGGAGGCGCCTCCCCAGGAGG - Intergenic
1181653069 22:24271422-24271444 GGAGGAGCAGGGGCCACAGGCGG + Intronic
1182322948 22:29490115-29490137 GGAGGAGGAGAAGCCCCAGGAGG + Exonic
1183238657 22:36639570-36639592 GGAGGAGGAGTGGACAGAGGAGG - Intronic
1183475294 22:38032846-38032868 GCAGGAGGGGTGGCCACGGTGGG + Intronic
1184638731 22:45857231-45857253 GCAGGAGGAGGCTCTACAGCAGG - Intergenic
950710349 3:14809603-14809625 GCTGGAGGAGTGTCCAGAGGTGG - Intergenic
951281250 3:20752656-20752678 GCAGCAGGAGAGGCCACAGCAGG - Intergenic
951624479 3:24644917-24644939 GCGGGAGGAGTCACCACAGGGGG - Intergenic
955800242 3:62679031-62679053 GCAGCAGGAAGCACCACAGGTGG - Intronic
960608360 3:119531541-119531563 GCAGGAGCATGCACCACAGGCGG + Intronic
961492612 3:127265790-127265812 GCAGGAGGAGCAGGCACAGCAGG + Intergenic
966775747 3:183541375-183541397 GAAGGAGGAGCTGCCACAGTTGG + Intronic
968515124 4:1012497-1012519 GCAGCAGGAGCAGCAACAGGGGG - Exonic
969360533 4:6660549-6660571 GAAGGAGGAGTAGGCAGAGGAGG + Intergenic
969360558 4:6660648-6660670 GGAGGAGGAGTAGGCAGAGGAGG + Intergenic
970211605 4:13715809-13715831 GCAGGAGAATTTCCCACAGGTGG - Intergenic
971457870 4:26861053-26861075 GCCGGAGGAGTCGCCGGCGGCGG + Exonic
972034929 4:34507835-34507857 TCAGGAGGAGTAGCCAGAGGTGG - Intergenic
972915748 4:43876786-43876808 GCAGATGGAGTCTCCAAAGGAGG + Intergenic
977712663 4:100145551-100145573 GCAGGAGCAGGAGCCACAGCTGG - Intergenic
978885428 4:113761788-113761810 GCGGGAGGAGGCGCCGGAGGAGG - Intronic
986165170 5:5266700-5266722 CCAGGAAGAGTAGCCCCAGGAGG - Intronic
986301633 5:6482423-6482445 GCAGGAGCAGACGCCACGTGAGG - Intronic
992089404 5:73303863-73303885 GCTGGAGGAGGCCCCGCAGGTGG - Intergenic
997704100 5:135930615-135930637 GCGGGAGGGGTCGCTCCAGGGGG - Intronic
998250954 5:140552088-140552110 GCAGGACCACTCCCCACAGGTGG + Exonic
998424024 5:142012230-142012252 CCACGAGGAGGCGCCACTGGGGG + Exonic
1008535479 6:52503701-52503723 CCAGGAGCAGTGGCCACAGAAGG + Intronic
1009328162 6:62380053-62380075 GCAGGAGGAGTGGCCAGGTGCGG - Intergenic
1010939649 6:81901234-81901256 TAAGGAGGAGTCACCACAAGAGG + Intergenic
1014140632 6:117938473-117938495 GCATGAGGAGGCAGCACAGGGGG - Intronic
1016982171 6:149863801-149863823 GCAGCAGGAGCGGCCTCAGGAGG - Exonic
1017684197 6:156895531-156895553 GCAGGAGGGGACACCCCAGGAGG - Intronic
1018008059 6:159641682-159641704 GCATGAGGAGTGGGCACAGCAGG - Intergenic
1018646603 6:165954625-165954647 GAAGCTGGAGTCGGCACAGGTGG - Intronic
1019487099 7:1294379-1294401 CCAGGAGGAGGGGCCACAAGGGG - Intergenic
1019649912 7:2151321-2151343 GCAGGTGGGGTGGTCACAGGCGG + Intronic
1019933135 7:4236734-4236756 ACAGGAGGAGGCGTAACAGGTGG + Intronic
1020026783 7:4905112-4905134 CCAGGAGGAGGGGGCACAGGAGG + Intergenic
1022066607 7:26864777-26864799 GCAGGAGGAGGAGCCACTGGTGG + Intronic
1022793731 7:33714980-33715002 GCAGGAGGAGTAGCAGGAGGAGG - Intergenic
1025058648 7:55785515-55785537 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1025220482 7:57103430-57103452 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1026377880 7:69770438-69770460 GCAGGTGGAGGCGCCGCAGTGGG + Intronic
1028009893 7:85628332-85628354 GCAGTGGCAGTAGCCACAGGAGG + Intergenic
1029667569 7:102005706-102005728 GCAGGTGGAGTAGACAGAGGAGG - Intronic
1030197698 7:106868518-106868540 GAAGGAAGAGTGGCCACTGGTGG + Exonic
1033037252 7:137886313-137886335 ACAGAAGGAGTGGCCAGAGGTGG + Intronic
1034424465 7:151007310-151007332 GCAGGAGGAGGCATCCCAGGGGG - Intronic
1034529961 7:151689547-151689569 GCAGGAGAAGGCGGCAGAGGCGG + Intronic
1037928778 8:22865325-22865347 GCAGCGGGAGACGCCGCAGGGGG - Intronic
1038455352 8:27669125-27669147 CCAGGAGGAGTCGGGACAGAAGG + Intronic
1039381622 8:37091039-37091061 GCAAGAGGAGAAGCCAGAGGAGG + Intergenic
1040518965 8:48158998-48159020 GCAGGTGGAATCTCCACAGAAGG + Intergenic
1046087028 8:109450735-109450757 ACAGGAAGAGTCTCCCCAGGAGG + Intronic
1047641351 8:126824893-126824915 CCAGCAGGAGTTCCCACAGGGGG - Intergenic
1048251003 8:132866812-132866834 TCAGGAGGAGTAGACACAGGTGG + Intergenic
1049044146 8:140136311-140136333 GCAGCAGGAGCCCACACAGGAGG + Intronic
1049583433 8:143422729-143422751 GCAGGAGGGGTAGGCGCAGGAGG - Intronic
1049651502 8:143771854-143771876 GCAGGAGGAGGCGGCGCAGCGGG + Intergenic
1049729778 8:144170437-144170459 GCAGGAGGAGACGACAGAAGAGG - Intronic
1049769396 8:144372897-144372919 GGAGGAGGAGGGGCCACTGGTGG + Intergenic
1049769405 8:144372919-144372941 GGAGGAGGAGGGGCCACTGGTGG + Intergenic
1049769431 8:144372985-144373007 GGAGGAGGAGGGGCCACTGGTGG + Intergenic
1053123619 9:35562886-35562908 GCTGGAGGAGCCGACACTGGAGG - Exonic
1057250087 9:93494067-93494089 TCAGTAGGAGTCCACACAGGAGG - Intronic
1057354036 9:94320723-94320745 CCCGGAGGAGACGCCACAGGAGG + Intronic
1057653729 9:96936912-96936934 CCCGGAGGAGACGCCGCAGGAGG - Intronic
1060406968 9:123377612-123377634 GCAGGAGCAGCCCCCAGAGGCGG - Exonic
1061590062 9:131592330-131592352 GCAGGCGGAGACACCAGAGGGGG - Intronic
1062249397 9:135586766-135586788 GGAGGAGGCGTGGCCACAGTGGG + Intergenic
1062369384 9:136229818-136229840 GCAGGAGAGGTGGCCAGAGGAGG - Intronic
1185489735 X:511990-512012 GCAGGGAGAGGGGCCACAGGTGG - Intergenic
1190084220 X:47381204-47381226 GCAGGAGGAGGAGCAGCAGGAGG + Intronic
1190747332 X:53332363-53332385 GCAGGAGCAGCCGCCACAGTGGG - Intergenic
1192436883 X:71148541-71148563 GCAGGTGGAATGGCAACAGGGGG - Intronic
1196871236 X:120115589-120115611 GCCGGAGGAGCCGGCCCAGGCGG - Exonic
1197757361 X:130005184-130005206 CCAGGGGGAGTGGCCACAGCAGG + Exonic
1199511531 X:148628039-148628061 GAAGGAGGAGAAGCCAAAGGTGG + Intronic