ID: 1122898494

View in Genome Browser
Species Human (GRCh38)
Location 14:104772226-104772248
Sequence GCTGCAGTCCTGGTACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122898494_1122898499 -6 Left 1122898494 14:104772226-104772248 CCTCCTTGTACCAGGACTGCAGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1122898499 14:104772243-104772265 TGCAGCAGGCTCCTGAGGTGAGG 0: 1
1: 0
2: 2
3: 32
4: 340
1122898494_1122898502 6 Left 1122898494 14:104772226-104772248 CCTCCTTGTACCAGGACTGCAGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1122898502 14:104772255-104772277 CTGAGGTGAGGGCGAGTGTGTGG 0: 1
1: 0
2: 4
3: 27
4: 387
1122898494_1122898500 -5 Left 1122898494 14:104772226-104772248 CCTCCTTGTACCAGGACTGCAGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1122898500 14:104772244-104772266 GCAGCAGGCTCCTGAGGTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 495
1122898494_1122898504 15 Left 1122898494 14:104772226-104772248 CCTCCTTGTACCAGGACTGCAGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1122898504 14:104772264-104772286 GGGCGAGTGTGTGGGAAATCTGG 0: 1
1: 0
2: 3
3: 8
4: 139
1122898494_1122898503 7 Left 1122898494 14:104772226-104772248 CCTCCTTGTACCAGGACTGCAGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1122898503 14:104772256-104772278 TGAGGTGAGGGCGAGTGTGTGGG 0: 1
1: 0
2: 2
3: 27
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122898494 Original CRISPR GCTGCAGTCCTGGTACAAGG AGG (reversed) Intronic
900760823 1:4469023-4469045 ACTGCTGTCCTTGTACAAAGAGG - Intergenic
901037508 1:6345141-6345163 CCTGCAGTCCTGGAAGCAGGAGG - Intronic
903136610 1:21313474-21313496 GCTGCAGTCTTGGTCCAGAGTGG + Intronic
908642601 1:66242027-66242049 GCTTCATTCCTGCTTCAAGGAGG + Intronic
914705591 1:150167283-150167305 CCTGTAATCCTGGTGCAAGGTGG + Intergenic
914915599 1:151817333-151817355 TCTGCAGCCCAGGTACATGGTGG - Intronic
915648121 1:157288411-157288433 CCTGAAGACCTTGTACAAGGTGG - Intergenic
915662549 1:157416095-157416117 CCTGAAGACCTTGTACAAGGTGG + Intergenic
915914063 1:159930779-159930801 GCTGCAGCCCTGGCACTAGGAGG + Exonic
916128358 1:161590842-161590864 GCTGCCTTCCTGGGAGAAGGAGG + Intronic
916138277 1:161672673-161672695 GCTGCCTTCCTGGGAGAAGGAGG + Intronic
916348582 1:163823142-163823164 GCAGCAGTCCTGGGACTAGAGGG + Intergenic
918554794 1:185785657-185785679 GCTGGAGTTCTGGGACAAGATGG - Intronic
918904385 1:190474686-190474708 GCAGAATTCCTGTTACAAGGAGG + Intronic
921476610 1:215617685-215617707 TCTCCTGTCCTGGTACAGGGAGG - Intronic
922724332 1:227915429-227915451 GCTGCTGTCAGGGTAGAAGGAGG - Intergenic
1062881347 10:980607-980629 GCTGCAGCCGTGGTTCAAAGGGG - Intergenic
1063186834 10:3659446-3659468 GGTGCAGTCCGGGAACATGGCGG + Intergenic
1064311947 10:14219522-14219544 TCTGAGGTCATGGTACAAGGTGG + Intronic
1065963674 10:30754055-30754077 GCTGCAAGCCTGGAATAAGGAGG - Intergenic
1066209609 10:33224024-33224046 GCTGCACTCCTGGAGCAAAGTGG + Intronic
1068120389 10:52778461-52778483 TCTGCAGTTCTGGGACAAGCAGG + Intergenic
1069563209 10:69445960-69445982 GCAGCAGTCCTAGTGCAAGAAGG - Intergenic
1072450405 10:95535006-95535028 GCACAAGTCCTGGTACAAGGAGG + Intronic
1073684977 10:105742370-105742392 ACTCCAGGCCTGGTACAATGGGG - Intergenic
1075905724 10:126080370-126080392 GCTGCTGTCCTGGCACATGTGGG - Intronic
1077185623 11:1234217-1234239 GCTGCAGTCCAGGTACACCATGG - Exonic
1084113593 11:67028923-67028945 CCTGCAGGCCTGGTGCAGGGTGG - Intronic
1084412420 11:69012530-69012552 GCCGCAGGCCTGGGAGAAGGTGG + Intronic
1085644305 11:78213257-78213279 GCTGACGTCCTGGTAGCAGGAGG + Intronic
1087066075 11:94029240-94029262 GAAGAAGTCCTGGGACAAGGAGG + Intronic
1090225747 11:125071235-125071257 GCTGCAGTCCTGCTTAGAGGGGG - Intronic
1092118575 12:6027232-6027254 TCTGCAGCCGTTGTACAAGGAGG - Intronic
1096249470 12:50019562-50019584 GCAGAAGTCCTGGGACAAGATGG + Intronic
1096251974 12:50039408-50039430 GCTGCAGCCCTTGTGCAACGTGG + Intergenic
1101229980 12:102730895-102730917 CCTGGACTCCTGGGACAAGGTGG + Intergenic
1101809092 12:108092281-108092303 CCTGCAGCCCTGGAACATGGAGG - Intergenic
1103862757 12:124027504-124027526 GCTGCAGTCCTGCAAGCAGGAGG - Intronic
1104319172 12:127734244-127734266 GCTGTAGTCCTGATAAAAGTGGG + Intergenic
1104722151 12:131050541-131050563 GCTACAGTCATGGCAGAAGGTGG + Intronic
1108483164 13:50895900-50895922 CCTGCTGTCCTGGTACACTGAGG + Intergenic
1110677858 13:78271238-78271260 TCTGCAGTCCAGGTACACTGGGG + Intergenic
1114535006 14:23417252-23417274 GCTGGAGTCCTCGCAGAAGGAGG - Exonic
1117744979 14:58860409-58860431 GCTGTAGGCCTGCTACTAGGAGG + Intergenic
1121359754 14:93245913-93245935 CCTGCAGTGCTGGTACAATCAGG + Exonic
1121814646 14:96919949-96919971 GCTGGTGTCCTGGTAAAAAGGGG + Intronic
1122226997 14:100285861-100285883 GCTGCGGTCCTGGGATTAGGGGG + Intergenic
1122898494 14:104772226-104772248 GCTGCAGTCCTGGTACAAGGAGG - Intronic
1126362612 15:47861734-47861756 GCTGCAGACCTGAGAAAAGGAGG + Intergenic
1127753603 15:62068566-62068588 GCAGAAGTCCTGGTCAAAGGAGG - Exonic
1128414179 15:67428917-67428939 GCTGCTGGCCTTGAACAAGGAGG + Intronic
1129170194 15:73802901-73802923 GCTGCAGGCCTGGCACAGGAAGG + Intergenic
1129672245 15:77613852-77613874 TCTGAGGTCCTGGTAGAAGGAGG + Exonic
1130256333 15:82327692-82327714 GCTGCTGACCGGGTACAAAGTGG - Intergenic
1130598619 15:85262296-85262318 GCTGCTGACCGGGTACAAAGTGG + Intergenic
1131321636 15:91399654-91399676 GCTGAAGTCCTTGTACATGTTGG + Intergenic
1133191384 16:4136063-4136085 GTTGTAGTCATGGTGCAAGGTGG + Intergenic
1135173424 16:20207062-20207084 GCTTCAGTCCTGCTACTAAGTGG + Intergenic
1135972960 16:27085541-27085563 GCTGCAGGCTTGGACCAAGGTGG - Intergenic
1137354187 16:47743408-47743430 CCTGCACTCCTGGTATAAGAAGG - Intergenic
1138103739 16:54275485-54275507 GCTTCACTCCTGGTGGAAGGAGG - Intergenic
1138650732 16:58459582-58459604 GCTCCAGTCCTGCTGCCAGGAGG - Intergenic
1139287652 16:65829977-65829999 GTTGCTGTCATGGTTCAAGGGGG + Intergenic
1139547845 16:67658020-67658042 GCTCCGGTCCTGGGAAAAGGCGG + Exonic
1141311548 16:82918094-82918116 GCTGGTGCCCTGGTAAAAGGTGG + Intronic
1142409904 16:89910738-89910760 GGCACAGTCCTGGTTCAAGGAGG - Intronic
1143029192 17:3958027-3958049 CCTGCAGTCCTGGGAAAAGAGGG + Intronic
1145005619 17:19336163-19336185 CCTGCAGTTCTGGCAGAAGGTGG - Exonic
1146054832 17:29575826-29575848 GCTGCTGTCCTGCTCCCAGGAGG - Exonic
1147871691 17:43592073-43592095 GCTGCTGCCCTGGTAAAATGGGG + Intergenic
1151246091 17:72796087-72796109 GCTGCAGTCCTAGCAAATGGAGG - Intronic
1151292863 17:73163062-73163084 CCTGCAGCACTGGTAGAAGGTGG + Intergenic
1203165535 17_GL000205v2_random:89657-89679 GCTGCAGCCCTGTGACAAAGGGG + Intergenic
1155231840 18:23781727-23781749 GCTGTCTTCCTGGTACAAGGAGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156331676 18:36129377-36129399 CCTGCAGTCCTGGGCGAAGGGGG - Intronic
1157670066 18:49520733-49520755 CCTGTAGTCCTGCTACTAGGAGG - Intergenic
1159909081 18:74126795-74126817 GCTGCAGTCCAGCTTCAAAGTGG + Intronic
1163126363 19:15246368-15246390 GCTTCTCTCCTGGCACAAGGAGG + Intronic
1165454396 19:35902368-35902390 GCTGCTGGCCTGGTCCAAGTGGG - Intergenic
1168077187 19:53987484-53987506 GCTGGAGGCCTGGACCAAGGTGG + Exonic
926810487 2:16751452-16751474 GCTGCATACCAGGTACTAGGAGG + Intergenic
927743900 2:25598207-25598229 GCTGCACTCCAGGTAGAAGAAGG - Intronic
928169196 2:28992452-28992474 GCTGGTGTCCTGGGACCAGGGGG + Intronic
929947642 2:46382551-46382573 GCTGTAGTCCTGGTACTGGGTGG - Exonic
930737421 2:54793803-54793825 GCTGCATTCCAGGCACCAGGAGG - Intronic
931696662 2:64876142-64876164 GCTGGAGCCCTGGTGAAAGGTGG + Intergenic
933895374 2:86806441-86806463 GCTGCAGGCCAAGGACAAGGAGG - Intronic
936151805 2:110025854-110025876 TCTGCAGTCCTGGGACAGGAGGG + Intergenic
936192869 2:110345515-110345537 TCTGCAGTCCTGGGACAGGAGGG - Intergenic
936247108 2:110837900-110837922 GCTGAGGTCCTGGGACACGGAGG - Intronic
939767353 2:146267366-146267388 GCTGCAGTCTTGGTGAAAGCAGG + Intergenic
942454817 2:176130390-176130412 GCTGTACTCCAAGTACAAGGCGG + Exonic
942538201 2:176987981-176988003 GCTGCAATGCTGGTCCAAGGGGG - Intergenic
946331775 2:219013618-219013640 TCTGGAGCCCTGGTACAAGTAGG + Intronic
946442849 2:219711368-219711390 GCAGGAGTCATGGTCCAAGGAGG + Intergenic
948711015 2:239825601-239825623 GCTGGAGTCCTCCTAAAAGGGGG + Intergenic
1171456885 20:25277186-25277208 GTTGCAGTGCTGGTGCCAGGAGG + Intronic
1172766904 20:37355858-37355880 GCAGCAGGCCAGGTACAAGGGGG + Intronic
1174102594 20:48138664-48138686 GCTGGAGTCCTGGCACAAAGGGG + Intergenic
1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG + Intronic
1176406217 21:6369422-6369444 GCTGCAGCCCTGTGACAAAGGGG - Intergenic
1178499554 21:33114569-33114591 GCTGCAGTTCTGGGACCTGGGGG - Intergenic
1179400679 21:41080322-41080344 GAGGCAGAGCTGGTACAAGGGGG + Intergenic
1179415260 21:41193302-41193324 GCTGCATACCAGGTACCAGGAGG + Intronic
1180577046 22:16786680-16786702 GCTTCAGCCCTGGTAGAAGTAGG - Intronic
1180917320 22:19498359-19498381 CTTGCAGTCCTGGCACACGGTGG + Intronic
1181089019 22:20459335-20459357 GCTGCATTCCTGGTAGGCGGCGG - Intronic
1184472004 22:44701680-44701702 GCTGAAGTCCCTGTCCAAGGGGG + Intronic
949128145 3:470879-470901 GCTCCAGCCATGGTTCAAGGGGG + Intergenic
949833273 3:8239980-8240002 GCTGCAGTCCTTGTGCAAAGGGG - Intergenic
952029832 3:29128264-29128286 GCTGCAGGCCCGGGACAAGCAGG + Intergenic
952130568 3:30356923-30356945 GACACAGTCCTGCTACAAGGGGG + Intergenic
952917042 3:38254504-38254526 CCAGCAGTCTTGGTAAAAGGAGG + Exonic
954453889 3:50586557-50586579 GCCGCAGACCTAGTACAAGAGGG - Intergenic
954879185 3:53822454-53822476 GCTGGGGTCCTGGAAGAAGGGGG - Intronic
959895561 3:111602122-111602144 GCTGCAGTCTTGGAACAATGTGG + Intronic
960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG + Exonic
960372883 3:116862671-116862693 GCTGCAGCCCTGGTTATAGGAGG + Intronic
961222557 3:125212270-125212292 GCTGCAGTCCTGCCAAAAGCCGG + Intronic
962315355 3:134355927-134355949 GCAGCAATCCTGGTACAGGGTGG + Exonic
964371851 3:156008382-156008404 CCTGCAGTCATGGAAAAAGGAGG + Intergenic
967106810 3:186260941-186260963 CCTGCAGTCCTGGGATCAGGAGG + Intronic
968269684 3:197393876-197393898 GCTGCCACACTGGTACAAGGAGG - Intergenic
968292045 3:197546601-197546623 GCTCCAGTCCTGGTACCACCAGG + Intronic
968644749 4:1734790-1734812 GCTGCACTCCTATTACAGGGAGG - Intronic
968726197 4:2248899-2248921 GGTGCAGGCCTGGCACCAGGAGG - Exonic
968898116 4:3416959-3416981 GATGCATTCCTGGTACAGCGGGG - Exonic
971898553 4:32627809-32627831 GCTGCAGTCCTTGAACGAGCTGG - Intergenic
979898501 4:126189820-126189842 GCTGCATACCAGGTACCAGGAGG + Intergenic
981459479 4:144996413-144996435 GCTGCTGTGCTGGTCTAAGGAGG + Intronic
986492605 5:8307774-8307796 GCTGCACTCCTGATCCAGGGAGG - Intergenic
986804131 5:11292352-11292374 GCTGGAGTCCTTCTAAAAGGAGG + Intronic
988348444 5:30069994-30070016 GCAGCAGTGTTGGCACAAGGTGG - Intergenic
990185836 5:53208195-53208217 GCTGCTGCCCTGGTTAAAGGAGG - Intergenic
992018643 5:72600443-72600465 GCAGCAGCCCTGGGAGAAGGAGG - Intergenic
992141219 5:73798961-73798983 CCTGCAGTCCTGCTACTTGGGGG + Intronic
992946845 5:81819533-81819555 GATGCATTCTTGGTCCAAGGCGG + Intergenic
996908800 5:128632820-128632842 GCTGCATACCAGGTACCAGGAGG + Intronic
998089740 5:139357864-139357886 CCTGCATTCTTGGTACAAGTTGG - Intronic
999147588 5:149406400-149406422 ACTGCAGTCCTGGGACACAGGGG + Intergenic
999369912 5:151048454-151048476 GTTGCAGTGCTGGTAAAAGGTGG + Intronic
1007337382 6:41163278-41163300 ACTGCAGCCCTGGCAGAAGGAGG + Intergenic
1008667521 6:53730936-53730958 TCTCCAGGCCTGGGACAAGGTGG - Intergenic
1009158391 6:60251021-60251043 GTTGCAGTCCAGGAACAATGAGG - Intergenic
1012820701 6:104082136-104082158 GCTGCATGCCAGGTACCAGGAGG - Intergenic
1013816487 6:114104530-114104552 GCAGCATTCCTGGTACCACGTGG + Intronic
1017662113 6:156685029-156685051 GCTACAGTCCAGATTCAAGGCGG + Intergenic
1019817889 7:3214547-3214569 CCTGCAGTCCTGGTACTTAGGGG + Intergenic
1020041810 7:5009301-5009323 GATGCAGTCCAGGCACAAAGAGG - Intronic
1023230532 7:38023132-38023154 CCTGCAGTCCCAGTCCAAGGGGG - Intronic
1025036618 7:55597239-55597261 GCTGCAGTCATGGTACCCGAGGG + Intergenic
1025655657 7:63516297-63516319 GTTTCAGTACTGGGACAAGGAGG + Intergenic
1026254416 7:68698327-68698349 GGTGCAATCTTAGTACAAGGAGG - Intergenic
1029402414 7:100354202-100354224 GCTGCTGTCCTAGGACATGGTGG - Intronic
1031848658 7:126836385-126836407 GCTGAATACCTGGTTCAAGGTGG + Intronic
1032507519 7:132446859-132446881 GCTGCAGGCCTGCTGCAAAGGGG - Intronic
1034113090 7:148557451-148557473 GCAGAAACCCTGGTACAAGGGGG - Intergenic
1034514802 7:151567482-151567504 GCTGCAGGCCTGGCACGTGGGGG + Intronic
1035607230 8:937939-937961 TCTGCAGTGCTGATCCAAGGTGG + Intergenic
1036239482 8:7070101-7070123 GCAGGAGGCCTGGGACAAGGAGG + Intergenic
1042022178 8:64379583-64379605 TCTGCAGTCCTGGGCCAAGCTGG + Intergenic
1042399681 8:68331179-68331201 GCCCCAGTCCGGGTAAAAGGAGG + Exonic
1048267323 8:132999034-132999056 GCTGCAGTCCTGGTTCTTGGAGG - Intronic
1049008803 8:139873922-139873944 GCTCCAGTCCTGGGAGAGGGAGG - Intronic
1053011873 9:34638122-34638144 GCTTCAGTCCTGGTAAAGGCGGG - Intronic
1055191342 9:73528312-73528334 GCAGCAGTCCTGAGACAATGAGG - Intergenic
1055544545 9:77355658-77355680 GCTGGAGTTTTGGTAGAAGGAGG - Intronic
1056103393 9:83322490-83322512 GCTGCAGAGCTGCTGCAAGGAGG - Intronic
1058458509 9:105160637-105160659 GCTGCTGTCCTGGAACAGGAGGG - Intergenic
1059633672 9:116152845-116152867 GCTGTAGTCCTAGTACAACTGGG - Intergenic
1060223207 9:121775140-121775162 GCTGCAGTCCATGTAGACGGAGG + Intronic
1061623526 9:131826757-131826779 GCTGCAGTCCTGCTGCAAGCGGG + Intergenic
1062255122 9:135617246-135617268 ACTGCGGGCCTGCTACAAGGCGG + Intergenic
1186578385 X:10790578-10790600 GCTGGAGTCCTGGTACTAGTGGG - Intronic
1187210465 X:17225886-17225908 CCAGAAGTCCTGGTACAGGGAGG + Intergenic
1188626724 X:32294209-32294231 GCTGGAGTCTTGGTATCAGGTGG - Intronic
1189613601 X:42763229-42763251 TCTGCAGTCCTGGTCCTCGGAGG + Intergenic
1191062212 X:56310648-56310670 GCTGCACTGCTGGCCCAAGGTGG + Intergenic
1192737720 X:73864369-73864391 GCTGGAGTCCTTGAACAAGCTGG - Intergenic
1198870628 X:141174822-141174844 GCTCCAGACATGGTACAATGAGG + Intergenic
1199858840 X:151781498-151781520 GCAGCAGGCCTGGCAGAAGGCGG + Intergenic
1199896635 X:152133161-152133183 GCTGCAGTCAAGTAACAAGGTGG - Intergenic
1202027942 Y:20544004-20544026 GCAGCAGTCCTGCTACATGACGG - Intergenic
1202069140 Y:20972458-20972480 CCTTCAGCCCTGGTACCAGGTGG - Intergenic
1202263522 Y:22994328-22994350 TCTGCGGTCCTGGCACAAGCAGG - Intronic
1202388629 Y:24348013-24348035 GCTCAAGCCCTGGTACTAGGGGG - Intergenic
1202416512 Y:24628069-24628091 TCTGCGGTCCTGGCACAAGCAGG - Intronic
1202454275 Y:25042017-25042039 TCTGCGGTCCTGGCACAAGCAGG + Intronic
1202482158 Y:25322115-25322137 GCTCAAGCCCTGGTACTAGGGGG + Intergenic