ID: 1122899090

View in Genome Browser
Species Human (GRCh38)
Location 14:104774747-104774769
Sequence GCACAGCCCCTAGCCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 268}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122899080_1122899090 10 Left 1122899080 14:104774714-104774736 CCCCACCCACCTGCCCGCACACG 0: 1
1: 0
2: 1
3: 42
4: 444
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899086_1122899090 4 Left 1122899086 14:104774720-104774742 CCACCTGCCCGCACACGGGAGCA 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899089_1122899090 -4 Left 1122899089 14:104774728-104774750 CCGCACACGGGAGCAGCGAGCAC 0: 1
1: 0
2: 0
3: 10
4: 71
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899079_1122899090 14 Left 1122899079 14:104774710-104774732 CCTGCCCCACCCACCTGCCCGCA 0: 1
1: 0
2: 6
3: 119
4: 1062
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899088_1122899090 -3 Left 1122899088 14:104774727-104774749 CCCGCACACGGGAGCAGCGAGCA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899083_1122899090 8 Left 1122899083 14:104774716-104774738 CCACCCACCTGCCCGCACACGGG 0: 1
1: 0
2: 1
3: 23
4: 302
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899081_1122899090 9 Left 1122899081 14:104774715-104774737 CCCACCCACCTGCCCGCACACGG 0: 1
1: 0
2: 0
3: 19
4: 213
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899077_1122899090 23 Left 1122899077 14:104774701-104774723 CCAGGGCCACCTGCCCCACCCAC 0: 1
1: 1
2: 5
3: 106
4: 872
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899085_1122899090 5 Left 1122899085 14:104774719-104774741 CCCACCTGCCCGCACACGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899087_1122899090 1 Left 1122899087 14:104774723-104774745 CCTGCCCGCACACGGGAGCAGCG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268
1122899078_1122899090 17 Left 1122899078 14:104774707-104774729 CCACCTGCCCCACCCACCTGCCC 0: 1
1: 0
2: 41
3: 321
4: 2299
Right 1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG 0: 1
1: 0
2: 2
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122899090 Original CRISPR GCACAGCCCCTAGCCCACAC TGG Intronic
900391848 1:2437034-2437056 CCACAGTCCCCAGCCCAGACAGG + Intronic
903501555 1:23802854-23802876 GCACAGGGCCTGGCCCACAGAGG + Intronic
905034499 1:34908758-34908780 ACCCAGCCCCTGGCCCACCCTGG + Intronic
907049663 1:51321685-51321707 GCACACCCCCTACCCCAACCGGG + Intronic
907392433 1:54167008-54167030 GCTCAGTGCCTAGCCCACAGGGG - Intronic
909061746 1:70886762-70886784 GCACAGATCCTGGCACACACTGG + Intronic
912552399 1:110492638-110492660 GCACAGCCGCAAACCCAGACAGG - Intergenic
913010798 1:114681640-114681662 CCACAGCCCGTTACCCACACAGG + Intronic
913070415 1:115293455-115293477 GCAGCTCCCCTAGCCCACTCAGG - Intronic
914196498 1:145450653-145450675 GCTCAGCCCCGACCCCACCCTGG + Intergenic
915244716 1:154548234-154548256 GCATGGCCCAGAGCCCACACTGG - Intergenic
920689397 1:208134438-208134460 GCTCAGCTCCTGGGCCACACTGG + Intronic
921098896 1:211911371-211911393 TCACTGCCCCTTGCCCACAGTGG - Intergenic
921544394 1:216456850-216456872 GCACAGCACACAGCTCACACAGG + Intergenic
922739920 1:228009028-228009050 GGACAGCCCTTTGGCCACACAGG + Intronic
923612001 1:235504204-235504226 GCGCGGCCCCGAGCACACACGGG + Exonic
923765051 1:236885452-236885474 GCACAGCCCCTAACACCTACTGG - Intronic
924469081 1:244323931-244323953 CCACAGCACCTGGCCCATACTGG + Intergenic
1063141954 10:3263680-3263702 GCCCAGCCCATACCCCAGACCGG + Intergenic
1063283808 10:4661230-4661252 GCACAGAGCCTAACCCACAGTGG - Intergenic
1067090438 10:43263671-43263693 GCTCAGCCCCTACCCCAGCCCGG + Intronic
1067275402 10:44828940-44828962 GCCAAGCCCCTGGCTCACACAGG + Intergenic
1067857558 10:49808539-49808561 TCACCGCCCCCAGCCCAGACTGG - Intergenic
1068967839 10:62931621-62931643 CCACTGCCCCTGGCCCACCCAGG - Intergenic
1070309369 10:75262111-75262133 GCGCAGCCCCTCGCTCACTCAGG + Intergenic
1070721228 10:78758512-78758534 GAGCAGCCCCTGCCCCACACGGG - Intergenic
1071503843 10:86221488-86221510 CCACAGCCCACAGCCCACAAAGG - Intronic
1072535602 10:96360393-96360415 GGACAGCCCCTAGGCTACTCAGG - Intergenic
1072540330 10:96393609-96393631 TCACAGCCCCAATCCCACCCTGG - Intronic
1076306998 10:129472514-129472536 GCACACACCCAAGCCCTCACTGG + Intronic
1076687304 10:132203947-132203969 GCAGAGCCCCTCACCCCCACTGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079894376 11:26100425-26100447 GCTCAGCCCCACTCCCACACTGG - Intergenic
1079935818 11:26614632-26614654 GGACAGCCCCTAATCCCCACAGG - Intronic
1081623818 11:44634871-44634893 GCACAGCCCCTCCCCCACCCAGG - Intergenic
1081751035 11:45511562-45511584 GAACATCCCCCAGCCCACACTGG + Intergenic
1083314100 11:61803594-61803616 GCACGGCCCCTAGACCAGACTGG + Intronic
1083724971 11:64623260-64623282 CCACAGCCCCTAGCCCAGCCAGG + Intronic
1084489067 11:69468455-69468477 GCACAGCGCCTGGCCCACAGTGG - Intergenic
1084717739 11:70884189-70884211 TCACAGCCCCGAGCCCTCTCTGG - Intronic
1084949528 11:72657121-72657143 GCACAGCCCCTGGCCCAGCTGGG + Intronic
1085508377 11:77073020-77073042 ACACAGCCCCCACCCCACCCCGG + Intronic
1087084407 11:94202035-94202057 GCACAGTCCCTGGCACACAGTGG - Intergenic
1089300905 11:117498054-117498076 GCACAGGCCTTTGCCCACTCTGG - Intronic
1089731937 11:120524751-120524773 AGGCAGCCCCTAGCTCACACTGG - Intronic
1090389691 11:126381058-126381080 GCACAGCCCCTCCCCAACCCGGG + Intronic
1091049252 11:132352702-132352724 GCACAGCCTCCAGCCCCCACAGG + Intergenic
1092200183 12:6577087-6577109 CCACCGCACCTGGCCCACACAGG + Intronic
1092217804 12:6694968-6694990 GCACAGCCCCCATCCCACTGAGG - Exonic
1096544900 12:52331302-52331324 GCAAAGCCCTTAGGCCACAATGG + Intergenic
1096579701 12:52576722-52576744 GCACAGGGCCCAGCCCACAGGGG - Intergenic
1097087936 12:56482593-56482615 GCAAAGTCCCTAGCACACAGTGG + Intronic
1097271799 12:57780127-57780149 TGACAGCCCAGAGCCCACACTGG - Intronic
1097687094 12:62701284-62701306 GGACAGCACCTAGCCCACTAGGG - Intronic
1098149989 12:67537078-67537100 TCTCAGCCCCTATCCCACATAGG + Intergenic
1098537186 12:71606243-71606265 CCACAGCCCCTGGCCCACTTTGG + Intergenic
1099956123 12:89353737-89353759 GCACAGCCCCGTGCCCAAGCGGG - Intergenic
1101877213 12:108603717-108603739 GCACAGTTCCTGGCACACACAGG - Intergenic
1102059540 12:109922430-109922452 GAACAGCCTGTGGCCCACACTGG + Intronic
1103624819 12:122210178-122210200 GCATAGCCCCGATCCCAAACTGG - Intronic
1104953301 12:132451936-132451958 GCACAGCCTGTGGCCCACAGAGG + Intergenic
1105617387 13:22030922-22030944 GCACAGCCTCTAGACCTCCCAGG - Intergenic
1105701997 13:22940766-22940788 GCACAGGCCCTGGCCCACTGCGG + Intergenic
1107128618 13:36871228-36871250 CCACTGCACCCAGCCCACACAGG - Intronic
1112306633 13:98280305-98280327 GCCCAGCCCCGAGCCCCCACGGG + Intronic
1112310825 13:98316275-98316297 GCAAAACCCCTAGCCAACAGGGG + Intronic
1118137621 14:63046085-63046107 GCACCGCCCTTACCCCACCCCGG + Intronic
1118947258 14:70399224-70399246 GCACTGCCCCAGGCCCACCCTGG + Intronic
1119080740 14:71691302-71691324 CCACAGCACCCAGCCAACACAGG - Intronic
1121089305 14:91170208-91170230 ACACAGCCCACAGCCCACAAGGG + Intronic
1121641123 14:95485564-95485586 CCACAGCCCCTAGACCTCCCAGG + Intergenic
1122043474 14:99007169-99007191 GCCCAGCTCTTGGCCCACACTGG + Intergenic
1122283557 14:100638317-100638339 GCCAGGCCCCAAGCCCACACTGG + Intergenic
1122353657 14:101111383-101111405 GCAGAGACCCCAGCCCACCCTGG + Intergenic
1122688680 14:103521637-103521659 GCCCAGCCCCGCGCCCACAGCGG - Intronic
1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG + Intronic
1124070705 15:26390680-26390702 GGACAGCCGCTTGCCCACAGTGG - Intergenic
1130062911 15:80582523-80582545 GCAGAGCCCCTAGCACACAATGG + Intronic
1130390279 15:83448156-83448178 GCCCAGCCCCGGGCCGACACCGG - Intronic
1132808837 16:1788093-1788115 GCACTGCCCAAAGCCCCCACCGG - Intronic
1135420646 16:22303509-22303531 TCACAGCCCCCAGCACACAGTGG - Intronic
1137735693 16:50721292-50721314 GCACAACGCCTGGCCCAGACAGG - Intronic
1139958100 16:70702793-70702815 CTACAGTCCCTAGTCCACACCGG + Intronic
1140451119 16:75071615-75071637 GAACAGTCCCAGGCCCACACAGG + Intronic
1140927246 16:79595700-79595722 GCACAGCCTATATTCCACACAGG + Intronic
1141453151 16:84119220-84119242 GCACAGGCACTAGCCAACCCTGG + Intergenic
1141605483 16:85150610-85150632 ACAGAGCCCCCAGCCCTCACAGG - Intergenic
1141727107 16:85796878-85796900 GCACAGCACCTAAACCTCACAGG - Intronic
1142202737 16:88768780-88768802 GCACCGCCCCCACCCCAGACTGG - Intronic
1143172221 17:4936952-4936974 GCACTGCCTCCAGCCCACAGTGG + Intergenic
1143517431 17:7426879-7426901 GCACAGCCCTTACCCCTCAGTGG + Exonic
1144561734 17:16326032-16326054 GGACAGCCCCTGGCCTACATGGG - Exonic
1144649877 17:17000660-17000682 GCTCAGCCCCCAGACCAAACTGG - Intergenic
1144941844 17:18947611-18947633 GCACAGCCACTAGCCCAGCAGGG + Intergenic
1144957636 17:19027173-19027195 CCACAGCCCCTAGCCCAGCCAGG - Intronic
1144977520 17:19147343-19147365 CCACAGCCCCTAGCCCAGCCAGG + Intronic
1145779278 17:27551713-27551735 CCACAGGGCCTTGCCCACACAGG - Intronic
1145944049 17:28759676-28759698 CTACAGCCCCTACCCGACACAGG - Exonic
1146062381 17:29614085-29614107 GCCCAGCCCCTCCCCCACCCCGG + Exonic
1147004816 17:37394054-37394076 CCACATCCCAAAGCCCACACAGG - Intronic
1147184056 17:38704295-38704317 TCACCCCCCCTTGCCCACACAGG + Intergenic
1148087124 17:45001024-45001046 GCTCCTCCCCTAGCCCCCACTGG - Intergenic
1148209043 17:45797134-45797156 GCCCAGCCCCCTGCCCACTCAGG - Intronic
1148341851 17:46878046-46878068 GCACAGCCCCTGGACCAGGCTGG + Intronic
1148678661 17:49460079-49460101 GCACAGTGCCTGGCCCACAGAGG + Intronic
1151758888 17:76089690-76089712 GCACAGCCACCTGCCCACCCTGG - Intronic
1152257343 17:79247939-79247961 GCACAGTGCCTGGCCCACAATGG + Intronic
1152257353 17:79247983-79248005 GCACAGTGCCTGGCCCACAATGG + Intronic
1152724997 17:81940808-81940830 GCCCAGCCTGTAGCCCACAGTGG - Exonic
1153948528 18:10037738-10037760 GCACAGCACCTGGCACACAGCGG + Intergenic
1155159691 18:23185528-23185550 GCAGAGCCCAGAGCCCAGACAGG - Intronic
1157220862 18:45827688-45827710 GCACAGCTCCTGGCCCTCAGTGG + Intronic
1157750352 18:50172974-50172996 CCACTGCGCCTGGCCCACACTGG - Intronic
1158227445 18:55215618-55215640 TCACAGGCCCTGGCCCACAGAGG - Intergenic
1158320967 18:56264109-56264131 GGGCAGCCCCTAGCCCAGTCAGG - Intergenic
1158348697 18:56541865-56541887 GCACAGCCCTTTGAACACACTGG + Intergenic
1159098929 18:63937084-63937106 ACTCAGCTCCTAGACCACACGGG + Intergenic
1160550796 18:79692803-79692825 GCACAGCTCCTGCCCCACACAGG - Intronic
1160985663 19:1837443-1837465 CCACAGCTCCTAGACCACACGGG + Intronic
1161571148 19:5031508-5031530 GCACAGCTCCAAGCCCACGTGGG - Intronic
1161680103 19:5675907-5675929 GCTCAGCACTCAGCCCACACGGG + Intronic
1162377661 19:10314814-10314836 CCACCGCGCCCAGCCCACACTGG - Intronic
1162864746 19:13537225-13537247 GAACAGCGCCTGGCCCACAGTGG - Intronic
1162964637 19:14150130-14150152 GCAGGGCCCCCAGCCCACAGGGG - Exonic
1163298039 19:16425082-16425104 GCACAGCCTCAAGCAAACACAGG - Exonic
1163603873 19:18263891-18263913 GCACAGCCCCGAGCTGCCACAGG - Intronic
1163813361 19:19448332-19448354 GCACAGGCCCTGGCCAACAGCGG + Intronic
1165128522 19:33617881-33617903 GCATGGCCCGGAGCCCACACAGG + Intergenic
1166046327 19:40233039-40233061 GCCCAGCCCATAGCCCCCAGTGG + Exonic
1166795580 19:45423595-45423617 GCTCCGCCCCTCGCCCCCACCGG + Intronic
926083930 2:10009617-10009639 GCACAGCCCCCACCGAACACAGG - Intergenic
927050268 2:19321331-19321353 CCACCGCGCCTGGCCCACACGGG - Intergenic
927195150 2:20541826-20541848 GCACAGCCGCTAGCCCGGGCAGG + Intergenic
928216667 2:29367193-29367215 GCACAGAGCCTGGCACACACTGG - Intronic
933676660 2:85063402-85063424 CCACAGCCCCTGGCTCCCACAGG + Intergenic
936466278 2:112754023-112754045 GCACAGTGCCTAGCACACATAGG + Intronic
936608239 2:113978377-113978399 TCACCCTCCCTAGCCCACACAGG - Intergenic
937136725 2:119559830-119559852 ACACACCCCCCACCCCACACAGG - Intronic
942225232 2:173808983-173809005 GGACATCCCTTAGCCCACTCAGG + Intergenic
942458598 2:176153996-176154018 GCACAGCCCCTCCCCTACACAGG - Intronic
942903145 2:181146713-181146735 TCACAGTCCCTATTCCACACAGG + Intergenic
943046470 2:182867072-182867094 CCGCAGCTCTTAGCCCACACAGG - Exonic
943395311 2:187326136-187326158 GAACATCCCTTAGCCCAGACAGG + Intergenic
944817644 2:203394703-203394725 GCACTCCCCCTATCGCACACTGG + Exonic
945046149 2:205783679-205783701 GCAAAGCTACTAGCCCCCACAGG + Intronic
947767495 2:232647038-232647060 GCAGAGCCACTGACCCACACGGG + Intronic
948391850 2:237617469-237617491 GAACAGCCCCTAACCACCACGGG + Intergenic
1168877315 20:1180669-1180691 GCCCAGCCCATGCCCCACACGGG - Exonic
1171023643 20:21609344-21609366 GCACAGTGACTAGCACACACAGG - Intergenic
1171459957 20:25292711-25292733 GCACTGACCCTAGCACACAGTGG - Intronic
1171779916 20:29409521-29409543 GCCCAGCACTTAGCCCGCACTGG + Intergenic
1171823898 20:29877803-29877825 GCCCAGCACTTAGCCCGCACTGG + Intergenic
1172245332 20:33442197-33442219 GCACAGCACCTGGCACACAGTGG + Intronic
1172774147 20:37397527-37397549 ACACAGCCCCACCCCCACACAGG - Intronic
1174485589 20:50859333-50859355 GAACAGTGCCTAGCTCACACAGG - Intronic
1174590778 20:51642959-51642981 CCCCAGCCCCCAGCCCCCACAGG + Intronic
1175229464 20:57464502-57464524 GCACAGCCTCCAGTTCACACAGG + Intergenic
1178630042 21:34251677-34251699 GCAAAGCTCCTAACCCACCCTGG - Intergenic
1179293925 21:40043884-40043906 GCACAGCCTTTACTCCACACAGG - Intronic
1179506450 21:41844882-41844904 ACACAGCCCCTCCCCCTCACAGG + Intronic
1179506507 21:41845049-41845071 ACACAGCCCCTCCCCCTCACAGG + Intronic
1179506587 21:41845281-41845303 ACACAGCCCCTCCCCCTCACAGG + Intronic
1179506596 21:41845307-41845329 ACACAGCCCCTCCCCCTCACAGG + Intronic
1179909527 21:44440674-44440696 GCACAGCTTCCAGCACACACAGG - Intronic
1179953757 21:44726773-44726795 GCACTCACCCAAGCCCACACAGG - Intergenic
1180181279 21:46119713-46119735 GCACAGCCCCCACCCTCCACAGG + Intronic
1181028857 22:20140548-20140570 GCCCAGCCCCCTGCCCACCCTGG + Intronic
1181488774 22:23248452-23248474 TCACATCCCCTAGACTACACTGG - Intronic
1181877695 22:25952864-25952886 AAACAGGGCCTAGCCCACACTGG - Intronic
1182277499 22:29200073-29200095 AGACATCCCCTAGCCCACCCTGG + Intergenic
1182681527 22:32083397-32083419 GCACAACCACTAGCCCAGACTGG - Intronic
1183094593 22:35544442-35544464 GCACAGCCCCTGGGCCAGTCAGG + Intronic
1183349506 22:37326981-37327003 GCACAATCCCTGCCCCACACTGG + Intergenic
1184080221 22:42214096-42214118 GCACACTGCCTTGCCCACACTGG + Exonic
1184488357 22:44795273-44795295 CCCCAGCCCAGAGCCCACACTGG - Intronic
1184778799 22:46635973-46635995 GCCCAGGCCCTTGCCCACTCAGG + Intronic
950207340 3:11091367-11091389 GCACAGCCAAAAGCCCAGACGGG + Intergenic
951553439 3:23897566-23897588 ACACACCTCCTAGCCCACTCTGG + Intronic
952333232 3:32383843-32383865 ACCCAGCCCTTTGCCCACACTGG - Intergenic
953561643 3:43997223-43997245 TCCCAGCCCCTAGTCCAAACGGG + Intergenic
954014965 3:47680380-47680402 GAAGAGCCCCTACCGCACACAGG + Intronic
954783580 3:53077470-53077492 CCAAAGCCACTAGCCCACAGAGG + Intronic
954809417 3:53238880-53238902 GCACAGGGCCTAGCCCCCAAAGG + Intronic
955956266 3:64293109-64293131 GCCCACCCCCTACCCCACACCGG - Intronic
956290311 3:67654311-67654333 GCGCCGCCCCTGCCCCACACTGG + Intronic
957077636 3:75614271-75614293 GAACAGCCCCTCTCCCCCACTGG - Intergenic
957085198 3:75670986-75671008 GCCCAGCACTTAGCCCGCACTGG - Intergenic
957210182 3:77248698-77248720 GCACAGGCCCTGGACCTCACAGG - Intronic
961006495 3:123409264-123409286 GCACAGCCCCTAGCACATAGAGG - Intronic
961035651 3:123639727-123639749 GCACATCCCCTGGCTCACAGTGG + Intronic
961456514 3:127027288-127027310 GCACAGCCCCGGGCCCTCAGCGG - Intronic
963138740 3:141930791-141930813 GCACAGTGCCTAGCACACAGTGG - Intergenic
967534967 3:190591663-190591685 TCATAGCCCCTAGCACTCACAGG + Intronic
968131149 3:196193689-196193711 GCACAGGCCCTGGCCCAGGCAGG + Intergenic
968350143 3:198046743-198046765 GCACAGCCTCTAGCCCAGGAGGG - Intergenic
968648236 4:1750297-1750319 AGGCAGCCCCCAGCCCACACAGG - Intergenic
968903573 4:3442022-3442044 CCCCAGCCCCTGGCCCCCACCGG + Exonic
968934843 4:3604639-3604661 GCAGAGCCCATTGGCCACACCGG + Intergenic
969251138 4:5969631-5969653 GCACAGCACCTGTCACACACAGG - Intronic
969704669 4:8785288-8785310 GCCCAGCCCCTGGCCCCCACCGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970466574 4:16329614-16329636 AAACAGACACTAGCCCACACAGG - Intergenic
971343025 4:25787921-25787943 GCTCAGCCGCCAGCCCCCACAGG - Intronic
972780115 4:42279889-42279911 TCCTAGCCCCTAGCCCACCCCGG - Intergenic
975374624 4:73629765-73629787 GCACAGCAACTTGCCCCCACAGG + Intergenic
977283018 4:95066154-95066176 GCACAGGCCCTAGGCCAGAAAGG + Intronic
980292008 4:130856070-130856092 ACGCAGACCCTAGCCCACATTGG + Intergenic
982976872 4:162075022-162075044 CCACAACCCCAAGCCCACAAGGG + Intronic
983647202 4:170003894-170003916 ACACAACCCCTAGCCCACACTGG - Intronic
984895506 4:184536171-184536193 GCACAGCATCTAGCACACAGTGG - Intergenic
984953088 4:185020655-185020677 GCACAGCCCCTTCCTGACACCGG + Exonic
987123595 5:14790936-14790958 GCACAGGCCCTAATACACACAGG - Intronic
989153920 5:38326176-38326198 GCACAACCACTGGCCCTCACAGG - Intronic
995251664 5:110000293-110000315 GCAGAGCGCCTAGCACATACTGG + Intergenic
995559472 5:113364890-113364912 GCAGTGTCCCAAGCCCACACAGG + Intronic
996822724 5:127648558-127648580 GGAAAGCCCCCACCCCACACAGG - Intergenic
997623164 5:135313789-135313811 TCACACCCTCTAGCCAACACAGG + Intronic
998172164 5:139878925-139878947 GCACAGCACCTGGCTCACAGTGG - Intronic
998717843 5:144906185-144906207 TCACAACTCCTAGCCCACAAGGG + Intergenic
999318965 5:150601468-150601490 GCACAGCCCCTCACCCACCCTGG - Intronic
1000213121 5:159128205-159128227 GCACAGCCTCTCGTCAACACAGG + Intergenic
1001591199 5:172866546-172866568 GCACAGCGCCTGGCCCCCATGGG - Intronic
1002021862 5:176368694-176368716 CCACAGCCCCCACCCCACCCCGG - Intronic
1002021880 5:176368732-176368754 CCACAGCCCCCACCCCACCCCGG - Intronic
1004171745 6:13300557-13300579 GCACATCTCCTAGCCCACGTGGG - Intronic
1006395221 6:33782785-33782807 GCACAGTGCCCAGCCCACAGCGG + Intronic
1011903660 6:92333844-92333866 GCACAACCCTCTGCCCACACTGG + Intergenic
1012529808 6:100221567-100221589 GCACAGCACCTAGCCCAGAGTGG + Intergenic
1013122909 6:107156720-107156742 GCACAGCTACCAGCCCACACTGG + Intronic
1013459078 6:110358206-110358228 GCACAGCCCCGAGTAGACACCGG + Exonic
1013548474 6:111183450-111183472 GCGCAGTGCCTAGCACACACTGG + Intronic
1015230790 6:130912767-130912789 ATTCAGCCTCTAGCCCACACTGG + Intronic
1015904148 6:138099076-138099098 GTACAGCCCATAGACCACAAAGG + Intronic
1018058952 6:160075286-160075308 GCACAGCACCTGGCACACAGCGG - Intronic
1018286853 6:162249856-162249878 ACACTGCACCTAGCCCACAAAGG - Intronic
1018672655 6:166192675-166192697 GCACAGCCCTTGGCCCTCCCGGG + Intergenic
1018758797 6:166872462-166872484 GCACAGCACGGGGCCCACACTGG - Intronic
1019423387 7:962222-962244 TCACAGCCCCTCGCCCACAGTGG - Intronic
1019526553 7:1483053-1483075 CCACAGGCCCAGGCCCACACAGG + Intronic
1019591269 7:1835351-1835373 GCACTTCCACTTGCCCACACTGG - Intronic
1019723605 7:2588137-2588159 GCACAGCCCACAGCCTGCACAGG - Intronic
1020386356 7:7607578-7607600 GCAGAGCCCCTATCCCACACTGG + Intronic
1021489279 7:21201073-21201095 GCCCAGCCCCCGGCCCACCCCGG - Intergenic
1022556035 7:31297321-31297343 ACACAGTCCCTAGCACACAGTGG + Intergenic
1023162224 7:37308649-37308671 GCACAGTACCTGGCACACACTGG + Intronic
1023181202 7:37485563-37485585 GCATGGCCCCTAGAGCACACTGG - Intergenic
1023947528 7:44815219-44815241 CCACAGCACCCAGCCTACACTGG - Intronic
1024564939 7:50673216-50673238 GGACTGCCCCTTGCCCTCACTGG - Intronic
1026925999 7:74194121-74194143 GCACAGCGCCTCACCCCCACCGG - Intronic
1029651052 7:101891996-101892018 GCACTGCCCATTACCCACACAGG - Intronic
1029799357 7:102930010-102930032 CCACCACCCCTAGCCCAAACTGG - Intronic
1032256545 7:130301888-130301910 GCAGAGCTCAGAGCCCACACAGG + Intronic
1033965746 7:146973313-146973335 CCACCGCGCCTGGCCCACACTGG + Intronic
1038516628 8:28193112-28193134 ACACAGCCACCAGCTCACACTGG - Intergenic
1039890512 8:41682593-41682615 GCACAGGCCCAGTCCCACACAGG + Intronic
1039971123 8:42322558-42322580 GCACTGCCGCCATCCCACACGGG + Intronic
1045231271 8:100309683-100309705 CCACGGCCCCGAGCCCACGCTGG + Intronic
1047986907 8:130244768-130244790 GGACAGCACCTGGCCCACAGGGG - Intronic
1048433261 8:134390415-134390437 TCACACCACCAAGCCCACACAGG + Intergenic
1048997932 8:139805527-139805549 GCACAGTGCCAAGCCCACACTGG - Intronic
1049562268 8:143317663-143317685 GCACGGCCCCTGCCCCAGACCGG - Intronic
1051726222 9:20089883-20089905 GCGCAACCCCAAGCTCACACTGG + Intergenic
1053729142 9:41034772-41034794 GCACAGCCCCAAGCACAGATGGG + Intergenic
1054455330 9:65427339-65427361 GCAGAGCCCATTGGCCACACCGG - Intergenic
1054699375 9:68397311-68397333 GCACAGCCCCAAGCACAGATGGG - Intronic
1056241579 9:84653123-84653145 GCAAAGACCCTAGCAGACACAGG + Intergenic
1057196641 9:93119276-93119298 GCACAGGGCCTAGCACATACAGG + Intergenic
1057206652 9:93177444-93177466 CCTCAGCCCCTAGCACCCACTGG - Intergenic
1058463991 9:105210171-105210193 GCACTGCACCTGGCCAACACTGG - Intergenic
1059401588 9:114073784-114073806 CCACAGCCCCCAGTCCCCACTGG + Intronic
1059623641 9:116036602-116036624 GCAAAGCCCCCAGCCCCCAGAGG + Intergenic
1059885677 9:118742208-118742230 GAGCAGCCTCTACCCCACACAGG + Intergenic
1060180001 9:121527435-121527457 CCCCAGCCCCCAGCCCCCACTGG - Intergenic
1060392874 9:123292962-123292984 TCACAACCACTAGTCCACACAGG + Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060785670 9:126450197-126450219 GCAGAGCCCCTGGCCCTCCCTGG + Intronic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1061323205 9:129845217-129845239 GCACTGCCCTGAGCCTACACAGG - Intronic
1061908386 9:133710417-133710439 GCGCAGCCCGGAGCCCAGACAGG + Intronic
1062044880 9:134420344-134420366 CCACAGCCCCCAGCACTCACAGG - Intronic
1062057401 9:134475651-134475673 GCACAGCCCCCACCCCATCCTGG - Intergenic
1062573905 9:137197826-137197848 ACCCAGCCCCAAGCCCCCACTGG + Intronic
1062637758 9:137500533-137500555 GCACAGACCTGGGCCCACACAGG + Intronic
1062698235 9:137886182-137886204 GCTCAGCCCCGACCCCACCCTGG - Intronic
1062711210 9:137976098-137976120 TCACAGACCCCAGCCCACACTGG - Intronic
1203376978 Un_KI270442v1:384319-384341 GCCCAGCACTTAGCCCGCACTGG + Intergenic
1190245573 X:48688410-48688432 GCACAGCCTCCAGCCCACCCTGG - Exonic
1190251553 X:48730883-48730905 AGACAGTCCCAAGCCCACACTGG + Intergenic
1190337615 X:49271726-49271748 GCTCAGCCCCTCGCCTCCACAGG - Intronic
1191688798 X:63919490-63919512 GCACAGTTCCTAGCACACAGGGG - Intergenic
1198026777 X:132714801-132714823 CCAGAGCCCCTGCCCCACACTGG + Intronic
1198112423 X:133513637-133513659 GCACAGGCCCTAGATCAGACAGG - Intergenic
1199715356 X:150503890-150503912 GCACAGCCCCTGTCCCCCTCAGG - Intronic
1199720707 X:150541126-150541148 GCAAGGCCCCGAGCCCTCACAGG - Intergenic
1199975641 X:152893520-152893542 GCACGGCCCCTAGCCGGCAGTGG + Intergenic
1200060169 X:153480545-153480567 GCAAGGCCCCCAGCCCACACTGG + Intronic
1200096605 X:153667517-153667539 GCTCAGCACCTAACCCACACTGG + Intergenic
1201291242 Y:12421780-12421802 GCCCAGCCCCTCGCCCACCGCGG + Intergenic