ID: 1122903053

View in Genome Browser
Species Human (GRCh38)
Location 14:104789821-104789843
Sequence CTGGGTCTGCACATCTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122903053_1122903063 13 Left 1122903053 14:104789821-104789843 CCCTGTTAGATGTGCAGACCCAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1122903063 14:104789857-104789879 GTCCAGCCACAGGTCCACACAGG 0: 1
1: 0
2: 0
3: 16
4: 172
1122903053_1122903061 3 Left 1122903053 14:104789821-104789843 CCCTGTTAGATGTGCAGACCCAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1122903061 14:104789847-104789869 CCTCGCCTGGGTCCAGCCACAGG 0: 1
1: 0
2: 0
3: 25
4: 176
1122903053_1122903057 -9 Left 1122903053 14:104789821-104789843 CCCTGTTAGATGTGCAGACCCAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1122903057 14:104789835-104789857 CAGACCCAGAGGCCTCGCCTGGG 0: 1
1: 0
2: 3
3: 28
4: 226
1122903053_1122903066 24 Left 1122903053 14:104789821-104789843 CCCTGTTAGATGTGCAGACCCAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1122903066 14:104789868-104789890 GGTCCACACAGGCCTGCAGCCGG 0: 1
1: 0
2: 2
3: 27
4: 269
1122903053_1122903056 -10 Left 1122903053 14:104789821-104789843 CCCTGTTAGATGTGCAGACCCAG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1122903056 14:104789834-104789856 GCAGACCCAGAGGCCTCGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122903053 Original CRISPR CTGGGTCTGCACATCTAACA GGG (reversed) Intronic
902685986 1:18077992-18078014 GTGAGTCTGCATTTCTAACAAGG - Intergenic
902879753 1:19363740-19363762 ACGGGGCTGCAAATCTAACAGGG + Intronic
906456329 1:46000412-46000434 CTGGGTCCTCGCACCTAACATGG - Intronic
916256168 1:162790269-162790291 CTGGATCTGTACATCCAAAAAGG + Intergenic
916508563 1:165450702-165450724 CATGGTCTGGCCATCTAACATGG + Intergenic
918097179 1:181345145-181345167 CAGGGTCTGCACACCTAGCTGGG + Intergenic
919806588 1:201384397-201384419 GTGGGTCTGCAGGTTTAACAAGG - Intronic
920690511 1:208143007-208143029 CTGGCTCCCCACATCTCACAGGG - Intronic
923655369 1:235911197-235911219 CTGGGTCAGCATTTCTAAAATGG + Intergenic
1062928309 10:1334980-1335002 CTTGGGCTGCACTTTTAACAAGG - Intronic
1065554344 10:26899984-26900006 CTGGGTCTCCACTTGTAAGATGG + Intergenic
1066722632 10:38355923-38355945 CTGGATCTGTACATCCAAAAAGG + Intergenic
1070886109 10:79901740-79901762 CTGTGTCTGAATATCTCACAAGG + Intergenic
1072805406 10:98420900-98420922 CTGGCTCAGCACATCCTACAGGG - Intronic
1073552240 10:104414425-104414447 TGGGCTCTGCACATCTATCAAGG - Intronic
1073819980 10:107250983-107251005 CTGGCTCTGCACAACTGTCAAGG - Intergenic
1074125287 10:110524390-110524412 CTGAGTCAGCAGCTCTAACAGGG - Intergenic
1077642070 11:3890427-3890449 CTGGGTATGTAGCTCTAACAGGG - Intronic
1079710962 11:23680981-23681003 CTGGGGCTGCACTTCCAACTGGG - Intergenic
1080593995 11:33752072-33752094 CTCAGTCTGGACATCTACCAGGG + Intronic
1082786540 11:57320389-57320411 CTGGGGCTGCACATCGAGCTGGG + Exonic
1083720393 11:64600917-64600939 CTGGTTCTGCACATCTTGGATGG - Exonic
1084039388 11:66532566-66532588 CTGGGTTTGCTCAGCTGACAAGG - Exonic
1085955147 11:81383640-81383662 TTGGGCCTGCATATGTAACAAGG + Intergenic
1087000574 11:93415998-93416020 CTGGGTATGCATACCTAAAATGG + Intronic
1091848526 12:3676886-3676908 GTGGGTCTGCAAATCTCACTGGG - Intronic
1092006571 12:5075157-5075179 CTGGGTCTGGAGATATAAGAAGG - Intergenic
1096775789 12:53963275-53963297 CTGGGTCTACACAAGTAGCAGGG + Intergenic
1102793809 12:115671322-115671344 CTGTGTCTGCTCACCTCACAGGG + Intergenic
1104803086 12:131568119-131568141 CTGTTTGTGCACATCTAAAAGGG - Intergenic
1104842085 12:131830165-131830187 CTGGGTCTGATCAGCCAACATGG - Intronic
1106436105 13:29724198-29724220 CTGGGGCTGGACATCCAAGATGG + Intergenic
1106467732 13:30027677-30027699 CTGAGTCTGCAGACCTAACATGG - Intergenic
1107378766 13:39833254-39833276 CTGGTACTGCACGTCTAACATGG - Intergenic
1112197598 13:97241166-97241188 CTGGGTCAGCACATCCAGGAAGG - Intronic
1113398838 13:109973347-109973369 CTGGGTTTGCACTCTTAACACGG - Intergenic
1114870988 14:26658393-26658415 CTGGGTTTGAAAATCTAACATGG - Intergenic
1117619142 14:57566443-57566465 CAGGATCTGCACATGTCACATGG + Intronic
1118552907 14:66976514-66976536 CTGGATCTTCATATCTTACAAGG + Intronic
1120194604 14:81468055-81468077 CTGGAGCTGAACATCCAACATGG - Intergenic
1122903053 14:104789821-104789843 CTGGGTCTGCACATCTAACAGGG - Intronic
1126229803 15:46311485-46311507 CTGGGTCTGCCCACAGAACAGGG + Intergenic
1126262480 15:46710623-46710645 CTGTGTCTTCACAGCTTACAAGG + Intergenic
1128155597 15:65389785-65389807 CTCTGTCTCCCCATCTAACAGGG + Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1129371512 15:75098824-75098846 CTGGGTTTAGACATCAAACAAGG + Intronic
1138180208 16:54936168-54936190 CTGGGGCTGCATATTCAACAGGG - Intergenic
1144394339 17:14828962-14828984 CTGAGTCTTCATATTTAACATGG - Intergenic
1151521810 17:74635573-74635595 CTGAGTCTGCCCATTTAAAAGGG - Intergenic
1153819994 18:8824855-8824877 CTGGGACTACACACCCAACAGGG + Exonic
1156242656 18:35268276-35268298 CAGGGTATTCACATATAACATGG + Intronic
1156260923 18:35444482-35444504 CTGTGTCTGCACATCAACCTTGG - Intronic
1158388453 18:57021380-57021402 CTGGGTCTGTGACTCTAACAGGG + Intronic
1164802295 19:31087681-31087703 CTAGCACTGCACATCTCACATGG + Intergenic
1165801396 19:38552897-38552919 CTGGGGCTGCACAGATCACAGGG + Intronic
929040290 2:37738034-37738056 CTAGGTCCACAAATCTAACATGG - Intronic
930874944 2:56204666-56204688 CTGGGCCTGGACTTCTGACATGG + Intronic
937099277 2:119256274-119256296 CTGGCTCTGCTCATCTCAGAAGG + Intronic
938127151 2:128682784-128682806 CTGGGTCTACACAGCCACCATGG - Intergenic
939783607 2:146480517-146480539 CTGATTCTGCATTTCTAACAGGG - Intergenic
947374758 2:229484331-229484353 CATGGTCTGTACATCTAACTTGG + Intronic
1168839897 20:903268-903290 CTGGGTCTGAACAACTAGAAGGG - Intronic
1170732986 20:18990175-18990197 CTGGGGCTGCACCTCCAAAAGGG + Intergenic
1170960386 20:21020277-21020299 CTGTGTCTGCACATCCAAGGCGG - Intergenic
1171116214 20:22526843-22526865 CTGGGTGTTCACATCCGACATGG - Intergenic
1171516383 20:25741472-25741494 CTGGGAGTGCACACCAAACATGG + Intergenic
1174117402 20:48236392-48236414 CAGGGTGAGCACACCTAACAAGG - Intergenic
1178477783 21:32952558-32952580 CTGGTTCTCCACATCTTCCAAGG - Intergenic
1183781641 22:40002683-40002705 CTGTTTCTGCATCTCTAACATGG + Intronic
1184618183 22:45652430-45652452 CAGGGTCTCCATATCTACCAGGG + Intergenic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
965471690 3:169100920-169100942 CAAGGTCTGCAAACCTAACACGG - Exonic
965539446 3:169857780-169857802 CTGGGTTTGAACTTCTACCATGG + Intronic
967917981 3:194592944-194592966 ATGGGTCTAGCCATCTAACAAGG + Intronic
968079773 3:195837830-195837852 CTTGGGCTGCACATCCCACAAGG - Intergenic
968764260 4:2459831-2459853 GTGGGTCTGCACATCTCAGCTGG - Intronic
969182784 4:5455085-5455107 CTGGGTGTGCACATCTGAGGGGG + Intronic
969390332 4:6888099-6888121 CTGGAGCTGCAGATCCAACAAGG - Intergenic
972021264 4:34316885-34316907 CTGAATCTGCACATCTAAACAGG + Intergenic
973236072 4:47907242-47907264 CTGTGTCTGCTGAGCTAACATGG + Intronic
974394831 4:61321329-61321351 CTATGTCTGCACATCTGGCAAGG + Intronic
983664009 4:170162340-170162362 CTGAGTCTTCACATCTCACCTGG + Intergenic
986023656 5:3828952-3828974 CTGGGGCTGCAGATCCAAGATGG + Intergenic
987070709 5:14334701-14334723 CTGTGTCTGCATCTCTATCATGG - Intronic
990525118 5:56617818-56617840 CTGGGGCTGCACAACCAATATGG - Intergenic
1004829256 6:19459837-19459859 TTGGGTCTGCAGAACTAGCAAGG - Intergenic
1006283242 6:33073112-33073134 CTGGGTCTGGACTTCAAACTTGG + Intronic
1008639390 6:53445984-53446006 CCCGGGCTGCACACCTAACATGG + Intergenic
1011212416 6:84968385-84968407 CTGAAACTGCACATCTCACACGG - Intergenic
1018537753 6:164839507-164839529 CTCGTTCTTCTCATCTAACAAGG - Intergenic
1020768745 7:12359610-12359632 TTGGGTCTACAAATCAAACAAGG + Exonic
1022177456 7:27885333-27885355 CTGAGTCTCCACATTTAAAAGGG + Intronic
1023092880 7:36632957-36632979 CTTTGTCTCCACATCTTACATGG - Intronic
1023702789 7:42909564-42909586 CTGGGTCTTCCCATCTAAACTGG - Exonic
1024186547 7:46954144-46954166 CTGGGTCTGCAGATATAACTGGG - Intergenic
1024295996 7:47842783-47842805 CTTGGCCTGCACATCTGTCAGGG - Intronic
1024513030 7:50218108-50218130 CTGGGATTGCACATCTCACATGG + Intergenic
1026266043 7:68796931-68796953 CTGTGTCAGCTCATCTAAAAGGG - Intergenic
1031326136 7:120400759-120400781 CTGTGACTGTGCATCTAACAAGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1055793263 9:79946516-79946538 CTTTGTCTCCACATTTAACAGGG - Intergenic
1055898737 9:81210638-81210660 CTGGGTCTGCCCATGAAACATGG - Intergenic
1059718413 9:116934955-116934977 CTGAGTTTGCACATCTAGAACGG - Intronic
1062173443 9:135148036-135148058 CTGGCTGTGCACATTTGACATGG + Intergenic
1062641640 9:137521661-137521683 CTGGCTCTGCACAACTACCTCGG - Exonic
1186240228 X:7557548-7557570 TTGGGACTGCACATAGAACATGG - Intergenic
1186265669 X:7830871-7830893 CTGGGTCTGCTCCTGCAACATGG + Intergenic
1187120423 X:16400419-16400441 CTGGGTCTGAACAACTAAGACGG - Intergenic
1189580695 X:42403250-42403272 ACGGGGCTGAACATCTAACACGG + Intergenic
1190006071 X:46739407-46739429 CTTGCTCTGCACATGTCACAGGG + Intronic
1192717628 X:73660664-73660686 CTGGGTCTGCAGATCCTGCAGGG + Intronic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1195004188 X:100670426-100670448 CTGTGTATGCACATCATACATGG - Intronic
1196152197 X:112387466-112387488 CTGGGTCTGGCCATCCAGCAGGG - Intergenic
1198119987 X:133582899-133582921 CTGGGTTTGCTTTTCTAACATGG + Intronic
1198938172 X:141921838-141921860 CTGTGTCTACACATCCAATAAGG + Intergenic
1202038357 Y:20658164-20658186 CAGGGTCTGCACAAAAAACATGG + Intergenic