ID: 1122903671

View in Genome Browser
Species Human (GRCh38)
Location 14:104792346-104792368
Sequence TTCCTGGTGTGGGCCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122903671_1122903675 -10 Left 1122903671 14:104792346-104792368 CCTGCCAGGGCCCACACCAGGAA 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1122903675 14:104792359-104792381 ACACCAGGAAGCCACTCAGATGG 0: 1
1: 0
2: 5
3: 28
4: 232
1122903671_1122903684 20 Left 1122903671 14:104792346-104792368 CCTGCCAGGGCCCACACCAGGAA 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1122903684 14:104792389-104792411 TGCACAGGGCCTCATCCTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 264
1122903671_1122903680 6 Left 1122903671 14:104792346-104792368 CCTGCCAGGGCCCACACCAGGAA 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1122903680 14:104792375-104792397 CAGATGGCCGGCCCTGCACAGGG 0: 1
1: 0
2: 1
3: 21
4: 150
1122903671_1122903677 -6 Left 1122903671 14:104792346-104792368 CCTGCCAGGGCCCACACCAGGAA 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1122903677 14:104792363-104792385 CAGGAAGCCACTCAGATGGCCGG 0: 1
1: 0
2: 0
3: 33
4: 273
1122903671_1122903679 5 Left 1122903671 14:104792346-104792368 CCTGCCAGGGCCCACACCAGGAA 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1122903679 14:104792374-104792396 TCAGATGGCCGGCCCTGCACAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122903671 Original CRISPR TTCCTGGTGTGGGCCCTGGC AGG (reversed) Intronic
900243512 1:1627586-1627608 GTCCTGGGGTCGGGCCTGGCGGG + Intronic
900284937 1:1894540-1894562 CTCCAGGGATGGGCCCTGGCTGG - Intergenic
900316711 1:2060680-2060702 ATCCGGAGGTGGGCCCTGGCAGG + Intronic
900419340 1:2548944-2548966 TTCCTGCAGTCGGCCCAGGCAGG + Intergenic
900425871 1:2578371-2578393 TTCCTGCAGTGGGCACGGGCAGG - Intergenic
900488764 1:2935932-2935954 TTCCTGGAGTGGGCACAGGGAGG + Intergenic
900547162 1:3235591-3235613 GACCTGGTGTGGGGACTGGCAGG - Intronic
901068688 1:6506685-6506707 TTCCTGGGGAGGGTCCAGGCAGG - Intronic
901935429 1:12623042-12623064 GGCCTGGGGTGGGGCCTGGCAGG + Intergenic
902976172 1:20090187-20090209 ATCCTGCTGTGTGCACTGGCAGG - Intronic
903069619 1:20720726-20720748 GACCTGATGTGGGCCCTGCCGGG - Intronic
905792748 1:40798986-40799008 GGCATGGGGTGGGCCCTGGCTGG + Intronic
907272751 1:53300410-53300432 TTGGTGTTGTGGGCCCTGGCTGG - Intronic
908032868 1:60020162-60020184 TTCGTGGGCTGGGCCCAGGCTGG + Intronic
908947875 1:69522290-69522312 TTGCTGTTGTCGGCCCGGGCTGG + Intergenic
913385672 1:118255866-118255888 GTGATGGTGTGGGCCCTGGGAGG + Intergenic
915100162 1:153493446-153493468 TGCCTGGGGTGGGCCGTGGAGGG - Intergenic
916819085 1:168380728-168380750 TTACAGGTGTGAGCCCTGCCTGG + Intergenic
919976375 1:202615632-202615654 TGCCTGGCCTGGCCCCTGGCTGG + Intronic
920497253 1:206463977-206463999 TTCCTGGTGTGGACTCTGAAGGG + Exonic
921614212 1:217247705-217247727 TTCCTGGTGAGGGCTCTTCCTGG - Intergenic
921964252 1:221071107-221071129 TCCCTTGTGTGGGCCCTGGTTGG + Intergenic
922580169 1:226691388-226691410 GTGCTGGGGTGGGGCCTGGCTGG + Intronic
922751946 1:228074126-228074148 TGCCTGGTCTGGGGCCTGACAGG - Exonic
1063227986 10:4034114-4034136 TTCCTAGTGTGAGGCCAGGCGGG - Intergenic
1064080315 10:12302875-12302897 TTCCTGGTGTTTCCCCTGCCTGG + Intergenic
1065319406 10:24495236-24495258 TGCCTGGGATGAGCCCTGGCTGG + Intronic
1065818708 10:29506303-29506325 TTCTTGGGGTGGACACTGGCTGG + Intronic
1065954212 10:30678093-30678115 TTCTTGGGGTGGACACTGGCTGG - Intergenic
1067052339 10:43029108-43029130 GTCCTGGCTTGGCCCCTGGCTGG - Intergenic
1067525498 10:47036011-47036033 TCCCAGGTGTGGGGCCTGGCAGG + Intergenic
1068564804 10:58562930-58562952 TTTTTGGTGTGGGGCCTGCCAGG + Intronic
1069686678 10:70323366-70323388 CTGGTGGTGAGGGCCCTGGCAGG + Intronic
1071456247 10:85853650-85853672 ATCCTGGTGTGGTCAGTGGCTGG - Intronic
1074052426 10:109892273-109892295 TTCCTGCTGTGGTCACTAGCAGG + Intronic
1074354967 10:112774389-112774411 ATCCTGGGGTGGCCCCTGGATGG - Intronic
1074772005 10:116741121-116741143 TCCCTGGAGTGAGCCCTGTCAGG + Intronic
1075344084 10:121669723-121669745 CTCCAGGTGTGGGACGTGGCAGG + Intergenic
1075798212 10:125135806-125135828 CTCCTGCTGTGGGGCCAGGCAGG - Intronic
1076168664 10:128302432-128302454 TTCCGAGTGTGGGGCCTGGGAGG + Intergenic
1076511999 10:131020388-131020410 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512009 10:131020412-131020434 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512019 10:131020436-131020458 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512029 10:131020460-131020482 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512039 10:131020484-131020506 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512049 10:131020508-131020530 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512059 10:131020532-131020554 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512069 10:131020556-131020578 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512079 10:131020580-131020602 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512089 10:131020604-131020626 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512166 10:131020825-131020847 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512176 10:131020849-131020871 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076512186 10:131020873-131020895 TGCGGGGTGTGGGCCCTGGAGGG - Intergenic
1076658593 10:132040252-132040274 TTCCTGGTGAGGGTCCTTCCTGG - Intergenic
1076764781 10:132627134-132627156 TTCCTGGTGAGGGTCCTTCCTGG - Intronic
1076791455 10:132779042-132779064 TGCCTGGTGGGGGCCTGGGCTGG + Intronic
1076815171 10:132911072-132911094 AGCCTGCTGTGGGCCCTGGGAGG - Intronic
1077122294 11:915222-915244 TTCCACGTGTGGGCCCCCGCTGG + Intergenic
1077207547 11:1352094-1352116 TTCCAGGTGTGAGGCCTGGAAGG - Intergenic
1077207722 11:1352512-1352534 TTCCAGGTGTGAGGCCTGGAAGG - Intergenic
1077469140 11:2748633-2748655 TCCCTGCTGTGGGCTCTGGGTGG - Intronic
1077899580 11:6478024-6478046 TGCCAGGTGTGGGCACTGGCAGG - Exonic
1078564049 11:12398348-12398370 GACCAGGTGAGGGCCCTGGCTGG + Intronic
1080225574 11:29956535-29956557 TCCTTGGTGTGGGCCCTGAAAGG - Intergenic
1080727925 11:34916277-34916299 TCCCTGGTCTGGGCCATGTCTGG - Exonic
1081564689 11:44250713-44250735 TGCCTGGTGAGGGCCCTGCATGG + Intergenic
1081684578 11:45033188-45033210 CTCCTGGTGTGGCCTCTGGCTGG + Intergenic
1081751401 11:45513760-45513782 TTCCTGCTGTGGGTGCTGACAGG + Intergenic
1083627174 11:64077770-64077792 TGGCTGGACTGGGCCCTGGCTGG + Intronic
1083719975 11:64599234-64599256 TGCCTGGTGTGGGGCCAGGGAGG + Intronic
1084218317 11:67663469-67663491 TGCCAGCTGTGTGCCCTGGCCGG - Intronic
1084674948 11:70628852-70628874 GTACTGCTGTGGGCTCTGGCTGG + Intronic
1085700147 11:78738608-78738630 TTCATGGTCAGAGCCCTGGCTGG + Intronic
1085725500 11:78951298-78951320 TTCCTGGTGTGTGCTCTGTGTGG - Intronic
1086257482 11:84894913-84894935 TGCCTGGTGAGGGCACTAGCAGG - Intronic
1090951606 11:131478325-131478347 TTCCTGATGTGTGCCCTGTAGGG - Intronic
1091659533 12:2373041-2373063 TTCCTGGTCTGGTCTGTGGCGGG + Intronic
1092286899 12:7133737-7133759 TTCTTGGTGTTGGCCCCGTCGGG - Exonic
1092651415 12:10639442-10639464 TCGCTGTTGTGGGCCCAGGCTGG + Intronic
1096878533 12:54648660-54648682 TTTCTGGAGAGGGCCCTGGCAGG + Intergenic
1097884691 12:64717348-64717370 TTTTTGGTGGGGGCGCTGGCAGG + Intronic
1098281906 12:68870537-68870559 TGCCAGGTGTGGGTCATGGCAGG - Intronic
1100329805 12:93572097-93572119 TTCCTGGTGCCCGCTCTGGCGGG - Exonic
1100917199 12:99437611-99437633 TTCCTGGTCTGTGCTCTGGGTGG - Intronic
1101588626 12:106107241-106107263 CTCCATGTGTTGGCCCTGGCAGG - Intronic
1101761161 12:107660186-107660208 TGCCTGGGTTGGGCCCAGGCTGG - Intergenic
1102492985 12:113299937-113299959 CTGCTGGTGTGGGTCCTGGCAGG - Exonic
1102569887 12:113820977-113820999 TTCACTGTGTGAGCCCTGGCAGG + Intronic
1102811477 12:115827868-115827890 TTGCTGGTGTGTGTCTTGGCAGG - Intergenic
1104672770 12:130691874-130691896 TTCCTTGTGGAGGCCCTGGGTGG + Intronic
1105409991 13:20163557-20163579 TGCCTGGGGTGCCCCCTGGCAGG + Intergenic
1105891368 13:24684854-24684876 TTCGCTGTGTGGGCTCTGGCAGG - Intronic
1108291700 13:48968164-48968186 TTGCTGTTGTTGGCCCAGGCTGG - Intergenic
1110288218 13:73774429-73774451 TTCCAGGTGTGGGCCGATGCAGG - Intronic
1110460938 13:75745119-75745141 AGCCTGGAGTGGGCCCTGGTGGG + Intronic
1112330372 13:98472927-98472949 TTTCAGGGTTGGGCCCTGGCAGG - Intronic
1112520255 13:100088857-100088879 CTCCTGGGGTCGGCTCTGGCCGG + Intergenic
1112660281 13:101499949-101499971 TTCCAGGTGTGGCCACTGGCTGG + Intronic
1113004313 13:105681117-105681139 TTGCTGATATGGGCCCTGCCTGG - Intergenic
1113943719 13:114032530-114032552 TTCGGGGTGTGCACCCTGGCAGG - Intronic
1113955529 13:114098373-114098395 TCGCTGGTGTGAGGCCTGGCTGG - Intronic
1114655020 14:24310782-24310804 TTCGTGGTGTGGAGCTTGGCGGG + Exonic
1118389887 14:65287258-65287280 CTCATGGTCTGGGCCCTCGCAGG - Intergenic
1118400418 14:65374431-65374453 TTCATGGTGTGGGCAGGGGCAGG - Intergenic
1118595638 14:67433110-67433132 TTCCTGGGTTGGGACATGGCTGG - Intergenic
1119756121 14:77120948-77120970 GCCCTTGTGAGGGCCCTGGCAGG + Intronic
1122864475 14:104597279-104597301 TTCCTGGGTTGGGCCCTGTGGGG + Intronic
1122883340 14:104699829-104699851 CTGCTGGTGAGGGCCCGGGCTGG + Intronic
1122903671 14:104792346-104792368 TTCCTGGTGTGGGCCCTGGCAGG - Intronic
1122945310 14:105005970-105005992 TGCCTGCTGTGGGGACTGGCTGG - Intronic
1123213927 14:106788589-106788611 GTCCTGGGGTGGGACCTGGTGGG + Intergenic
1123970549 15:25504262-25504284 TTGAAGGTGTGGGCCCAGGCAGG - Intergenic
1124492022 15:30163982-30164004 TGCCTGGCCTGGCCCCTGGCTGG + Intergenic
1124751515 15:32374335-32374357 TGCCTGGCCTGGCCCCTGGCTGG - Intergenic
1124929067 15:34101539-34101561 CTCCTGGTGGGGTCCCTGTCCGG + Intronic
1127361922 15:58251927-58251949 GTCCTGGTGTGGGAACTGCCAGG + Intronic
1127723620 15:61726381-61726403 TTCCTGGTGTCAGCCCTCCCCGG - Intergenic
1129827298 15:78642019-78642041 TCCCTTGTGTGGGCCCTAACAGG + Intronic
1130147149 15:81282900-81282922 CCCCTGTTGTGGGCACTGGCTGG + Intronic
1131432189 15:92395756-92395778 TTCCGGATGTGGGCACTGCCCGG + Intronic
1132196263 15:99916718-99916740 TTCCTCCTGGGGGCCCTGACTGG - Intergenic
1132523236 16:401107-401129 TTCCGCGTGGGGGCCCGGGCGGG - Intronic
1132731940 16:1367013-1367035 TGTCTGGGGAGGGCCCTGGCTGG - Intronic
1132861199 16:2072657-2072679 TTCCTGGTGTGTTACTTGGCAGG + Intronic
1133158154 16:3890305-3890327 TTCCTAGTGGGCACCCTGGCGGG - Intergenic
1133284103 16:4682701-4682723 GTCCTTGCGTGGGTCCTGGCAGG + Intronic
1133287557 16:4697661-4697683 ACCCGGGTCTGGGCCCTGGCTGG + Intronic
1135265235 16:21019752-21019774 TCCTTGGTGTGGACCGTGGCTGG - Exonic
1136164560 16:28444484-28444506 TTACTGGTGTGAGCCGTGCCTGG + Intergenic
1136198406 16:28670497-28670519 TTACTGGTGTGAGCCGTGCCTGG - Intergenic
1136214752 16:28784673-28784695 TTACTGGTGTGAGCCGTGCCTGG - Intergenic
1136259474 16:29064518-29064540 TTACTGGTGTGAGCCGTGCCTGG - Intergenic
1136390767 16:29962768-29962790 TCCCTTGTCTGGGCTCTGGCTGG + Exonic
1136552952 16:30991211-30991233 TGCCTGGTATGGCCCCTGCCTGG + Exonic
1136746909 16:32598431-32598453 TTCCTAGAGTGAGGCCTGGCTGG - Intergenic
1136994888 16:35182616-35182638 TTCCTGGCCTGGGCTCTGGGTGG - Intergenic
1137020410 16:35420112-35420134 TGGCTGGTGTGGGCCCTGCCAGG - Intergenic
1137445156 16:48527111-48527133 CTCCTGGTGTGGGCCATGGAAGG - Intergenic
1138289341 16:55833392-55833414 CTGCTGGTGTGGGCCCTTGGGGG - Intergenic
1138598301 16:58041125-58041147 TTTCTCGGGTGGGCCCTGGGTGG - Intronic
1139506662 16:67401426-67401448 GGCCTGGTGCAGGCCCTGGCTGG + Intronic
1142076466 16:88120837-88120859 ATCCAGGTGTGAGCCCCGGCTGG + Intergenic
1142150013 16:88508585-88508607 TGCCTGCCGTGGGCCCTGGTTGG + Intronic
1142153445 16:88522711-88522733 TCCCTCCTCTGGGCCCTGGCCGG - Intronic
1142171439 16:88624723-88624745 CTCCTGGGGGGGGTCCTGGCTGG - Exonic
1142171982 16:88627752-88627774 TTCCTGGTCTGGGCTGGGGCCGG - Exonic
1203049039 16_KI270728v1_random:857635-857657 TTCCTAGAGTGAGGCCTGGCTGG - Intergenic
1143024843 17:3935423-3935445 TGCCAGTGGTGGGCCCTGGCTGG + Intronic
1143172804 17:4939816-4939838 TTCCTGTTTGGGGGCCTGGCCGG - Exonic
1143177217 17:4962820-4962842 TTACAAGTGTGGGCCCAGGCTGG + Intronic
1143709861 17:8726793-8726815 CTCCTGGTCTGGGTCCTGGGAGG - Intergenic
1143804231 17:9413175-9413197 TCCCTGGTGTTGCTCCTGGCCGG - Intronic
1144741840 17:17587994-17588016 TTCCTGGGGTGATCTCTGGCTGG - Intronic
1144954054 17:19010309-19010331 CTTCTGGTGTGGGCCTTGGCTGG + Intronic
1145248565 17:21285128-21285150 GTCCAGGTGAGGGCCCAGGCGGG - Intronic
1145279098 17:21455438-21455460 GCCCTGGTGGGGGCCCTGGCAGG + Intergenic
1145793524 17:27642837-27642859 ACCCTGGTGTGGGCCCAGGGGGG - Intronic
1145808333 17:27750383-27750405 ACCCTGGTGTGGGCCCAGGGGGG - Intergenic
1146650554 17:34603638-34603660 TTCCCTGTGTGGGCTGTGGCAGG + Intronic
1146948535 17:36890383-36890405 TCCCTGGGGTGGGCCCTTGGGGG - Intergenic
1147423190 17:40332537-40332559 TCCCTGGGGCAGGCCCTGGCTGG + Intronic
1147659759 17:42111279-42111301 TCACTGGTGAGGGCCATGGCCGG - Exonic
1147718505 17:42523309-42523331 TCCCTGGTGTCGGCCCTGAGAGG + Intergenic
1147959001 17:44154782-44154804 CGACTGGTATGGGCCCTGGCTGG - Intronic
1150250686 17:63702770-63702792 TTCCTGGTGTGTGTGCTTGCAGG - Intergenic
1150292223 17:63988501-63988523 CTGCTGGGGTGGGCCGTGGCTGG - Intergenic
1151724205 17:75875249-75875271 CTCCTGGGGTGGTCCCCGGCGGG - Intronic
1151929033 17:77219204-77219226 TTCCAGAAGTGAGCCCTGGCAGG - Intergenic
1152778762 17:82217315-82217337 ATCCTGGTGTGGACACGGGCAGG + Intergenic
1152914237 17:83024692-83024714 TTCCTGGTGTGGGTCAGGCCTGG + Intronic
1152926225 17:83089018-83089040 TTCCTGGTGAGGAAGCTGGCGGG - Intronic
1153000663 18:452602-452624 TTCCAAGTGTTGGCTCTGGCAGG + Intronic
1155796920 18:30050156-30050178 ATCCTGGTGTGGGCTCAGGTAGG - Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1158283286 18:55851069-55851091 CTGCTGGGCTGGGCCCTGGCTGG - Intergenic
1159036706 18:63284935-63284957 TTCCTGGCGTCTGCCCTTGCTGG - Intronic
1160413085 18:78688072-78688094 ATCCAGGTCAGGGCCCTGGCAGG - Intergenic
1160946212 19:1645166-1645188 CCCCAGGGGTGGGCCCTGGCTGG - Intronic
1161039080 19:2100509-2100531 ATGCTGGTGTGGGCCGGGGCTGG + Intergenic
1161353078 19:3804410-3804432 TCCCTGATGTAGGCCTTGGCTGG - Exonic
1161382163 19:3971131-3971153 TCCCGGGGGTGGGCACTGGCGGG - Intergenic
1161687604 19:5711127-5711149 TGTCTGCTGTGGGCGCTGGCAGG - Intronic
1162181332 19:8871157-8871179 TTCCTGGTGGGGGCACTTGGGGG - Intronic
1162585010 19:11553173-11553195 TCCCTGGGCTGGGCCCTGACAGG - Exonic
1162808751 19:13151996-13152018 TTCCTGGTGCGGGCCCTTTAAGG - Exonic
1163757662 19:19116120-19116142 GTCCTGCTGTGGGCCTTAGCGGG - Intergenic
1165343447 19:35228233-35228255 TACCTGGTGGGAGCCCTGGCAGG - Exonic
1166751938 19:45168397-45168419 TTCCTGCTTTTGGCCCTGCCAGG - Intronic
1167418426 19:49389377-49389399 TGGGTGGTGTGGGCCTTGGCGGG - Intronic
1167492805 19:49801896-49801918 CCCCTGGGGTGGGCCCTGCCAGG + Intronic
1168087246 19:54057197-54057219 TTCCTGTCGTGGGACATGGCTGG - Intronic
1168145699 19:54419134-54419156 TTGCTGGTGGCGGCCTTGGCGGG + Exonic
925338069 2:3113260-3113282 CTCCTCCTGTGGGCCCTGGTGGG - Intergenic
926528391 2:14010840-14010862 TTCAGGGTTTGGGGCCTGGCTGG + Intergenic
926749344 2:16186125-16186147 TTCCTGATGTTCACCCTGGCTGG - Intergenic
927847551 2:26479382-26479404 TTCCTGGGGTGGGCAGAGGCGGG + Exonic
928439185 2:31277360-31277382 TTGCTGTTGTCGGCCCAGGCTGG - Intergenic
929237715 2:39624254-39624276 TTTCTGGTGGGGGCCATGCCTGG - Intergenic
929996439 2:46829038-46829060 TTTCTGGTGAGGGCTCTGTCTGG - Intronic
930066132 2:47329130-47329152 CTCCTGGGGTGGTCCCTGGTTGG - Intergenic
934847774 2:97673323-97673345 ATCTTGGTGTGGGCTATGGCTGG + Intergenic
935279398 2:101504646-101504668 TTCCTGGTGTGGGCTGGGGCTGG + Intergenic
935383631 2:102478892-102478914 ATCCTGGTGGGGGCGCTGGTGGG + Exonic
937310525 2:120900035-120900057 TTCCCAGTGTGGCCCCCGGCCGG - Intronic
937981938 2:127620779-127620801 GTCCAGGAGTGGGCCCTGCCTGG + Intronic
938404795 2:131025459-131025481 TTCCTGATGTTGGCTCTGCCAGG + Intronic
942702544 2:178730024-178730046 TGCCTGGGGTGGGCCGGGGCGGG - Intronic
946796695 2:223362080-223362102 TCCCTGGGGTGGGACCTGGGTGG - Intergenic
947492247 2:230604762-230604784 TTCCAGTTTTGTGCCCTGGCTGG - Intergenic
947914365 2:233822069-233822091 TTCCTGGCATGTGCCCTGGCAGG - Intronic
948469379 2:238167455-238167477 TCCCAGGTAGGGGCCCTGGCTGG - Intronic
948485405 2:238277847-238277869 TTCCTGCAGTGGGACCTGGCTGG + Exonic
948653664 2:239464115-239464137 GGCCTGGAGTGGGTCCTGGCTGG + Intergenic
948988489 2:241540254-241540276 ATCCTGGTGTGGGCTCAGTCTGG + Intergenic
1168793548 20:596108-596130 TTCCTGGGGAGGCCCCTGGGTGG + Intergenic
1168980973 20:2003216-2003238 TTCTGGGTCTGGGGCCTGGCTGG + Intergenic
1170629807 20:18057080-18057102 TTCCTCGTGGGCGCCTTGGCTGG - Intronic
1171971647 20:31568734-31568756 TTCATGCTGTGTGCCCTGGGAGG + Intronic
1172173959 20:32961206-32961228 TTGCTGGTCTGGGCCCCTGCTGG - Intergenic
1173699632 20:45057029-45057051 AGCAGGGTGTGGGCCCTGGCTGG + Intronic
1174298221 20:49563759-49563781 TGGCTGGTCTGGGCCCTTGCAGG - Intronic
1174414050 20:50355568-50355590 TCCTTCATGTGGGCCCTGGCGGG + Intergenic
1175820546 20:61906736-61906758 TGTGTGCTGTGGGCCCTGGCAGG + Intronic
1176118791 20:63444953-63444975 CGCCTGGTGTGGGCTCTGTCAGG + Intronic
1176696203 21:9980400-9980422 TTCCTTCTGTGGATCCTGGCAGG + Intergenic
1178958637 21:37044487-37044509 TTCCCTGTGAGGGCCCTGGATGG - Intergenic
1179590782 21:42406429-42406451 TTCCTGGTATCAGCCCTGGTGGG - Intronic
1179904151 21:44413588-44413610 GACCTGGTGCTGGCCCTGGCTGG + Intronic
1180106350 21:45620747-45620769 TTCCAGTTGGGGGCCCGGGCAGG + Intergenic
1180957573 22:19747770-19747792 TTCCTCCTGTGGCCGCTGGCTGG - Intergenic
1181322781 22:22021388-22021410 TTCCTGGTCTGGCCTCTGACTGG - Intergenic
1182093616 22:27612201-27612223 TCCCTGCTGTGGGCACTGGAGGG + Intergenic
1182558170 22:31140296-31140318 TTCCTGGGGGTGGCCCTGGGGGG - Exonic
1182673344 22:32016643-32016665 TTGCTGTTGTTGGCCCGGGCTGG - Intergenic
1183200128 22:36380229-36380251 TGGATGGTGTGGGCCCTGGGAGG - Intronic
1183663689 22:39235456-39235478 CTCCAGGTGTGGGCCCAGCCAGG - Intronic
1184143607 22:42595034-42595056 TTCCAGGGGTGGCCCTTGGCTGG + Intronic
1184486560 22:44783382-44783404 CTCCGGGTGTGGGTCCTGGCTGG - Intronic
1184867405 22:47209366-47209388 TGGCAGGTGTGGCCCCTGGCTGG - Intergenic
1185179178 22:49349409-49349431 TTGCTGGTTGGGGCCGTGGCTGG + Intergenic
949738289 3:7200014-7200036 TTCCTGGTGAGGGCACATGCTGG + Intronic
952504939 3:33999033-33999055 TTCCTGTTGTTGGCCTGGGCTGG + Intergenic
952858868 3:37795640-37795662 GGCCTGGTGCGGACCCTGGCTGG - Intronic
954565035 3:51592602-51592624 TTTCTTTTGTTGGCCCTGGCTGG + Intronic
954698697 3:52440793-52440815 TTCCTGCTGTGGCCCAAGGCCGG - Exonic
956608212 3:71094735-71094757 TTCCTGGTGTGGCTCCTGGTTGG - Intronic
961406929 3:126686292-126686314 CTCCTGGTGAGGGCTCGGGCTGG - Intergenic
962986574 3:140541668-140541690 TTCCTGGGCTGAGCCCTGGCAGG - Intronic
964647100 3:158969910-158969932 TTCCTGGGGTGGGCCCAAGTTGG - Intronic
966855332 3:184189752-184189774 ATCCAGGTGTGGGGCCTGGCAGG + Exonic
967017484 3:185495279-185495301 TGCCTTGTTTGGGCCATGGCTGG - Exonic
968065657 3:195757604-195757626 ATCCTGGTGTGAGCCCAGCCAGG - Intronic
968812110 4:2804760-2804782 TGCCTGGTAGGGGCCCTGCCAGG + Intronic
969447991 4:7256258-7256280 TCCCTCGTGGCGGCCCTGGCTGG - Intronic
969559529 4:7938813-7938835 TTCCTGCTCTGGCCCCGGGCTGG - Intronic
969562235 4:7956604-7956626 TTCCTGGCTGGGGCCTTGGCTGG + Intergenic
970364202 4:15341965-15341987 GCCCTGGGGTGGGGCCTGGCGGG - Intronic
970508369 4:16755813-16755835 TTCCTGGTGTTGTCCAGGGCGGG + Intronic
979927337 4:126583490-126583512 GTCCTGATGTGGGCAGTGGCGGG - Intergenic
980368812 4:131840624-131840646 TTCCTTCTGTGGATCCTGGCAGG + Intergenic
982605787 4:157514955-157514977 TTCCTGCTGAGGCCACTGGCTGG + Intergenic
983061447 4:163166258-163166280 TTGCTTGTGTGGGCCCTGGAGGG - Intronic
983664751 4:170168443-170168465 TTTCTGGTGAGGGCCCTTCCTGG + Intergenic
984886792 4:184456588-184456610 AGCCGGGTGTGTGCCCTGGCTGG - Intronic
985763027 5:1761359-1761381 CTCATGGTGTGGTCCCTGGGTGG + Intergenic
986911791 5:12566609-12566631 TTCCTGGAGTGGTCCCAGGAAGG + Intergenic
988099048 5:26655294-26655316 TTCCTGGTGGGTGGCCTGCCTGG - Intergenic
991626853 5:68611344-68611366 TTCATGGTGTTGGCTATGGCAGG - Intergenic
991941920 5:71861604-71861626 TTCCTGGAGTTGGGGCTGGCTGG + Intergenic
992759895 5:79942337-79942359 TTCCTGGGAAGGGTCCTGGCAGG - Intergenic
993410274 5:87565349-87565371 TTCCTGGTGTAGTCTCTGGAGGG + Intergenic
997208348 5:132063651-132063673 TCCCTGATGTTGGCCCTGGGAGG - Intergenic
999218272 5:149954297-149954319 TTCCTGCTGTTGGCCTTGGAGGG - Intergenic
1001471139 5:172013540-172013562 TTCTTAGTGTGGGACCTGGTGGG - Intergenic
1001986379 5:176076803-176076825 TTCCTAGAGTGAGGCCTGGCCGG - Intronic
1002230488 5:177761321-177761343 TTCCTAGAGTGAGGCCTGGCCGG + Intronic
1002264848 5:178022427-178022449 TTCCTAGAGTGAGGCCTGGCCGG - Intronic
1006022642 6:31126473-31126495 TTCCTGGTGTGGGCGGTGCTCGG + Intronic
1006209501 6:32383444-32383466 TTCATGGTGAGGGTCCAGGCAGG - Intergenic
1006360583 6:33584905-33584927 TTAGGGGTGTGGGGCCTGGCAGG + Intergenic
1006453397 6:34118393-34118415 TTCCAGGTGTGGGCAGGGGCAGG + Intronic
1006471095 6:34229201-34229223 ATCCTGGTGTGTGGCCTGGGAGG + Intergenic
1007171576 6:39867838-39867860 TTCCAGGTGAGGGGCCAGGCTGG + Exonic
1007295692 6:40819040-40819062 TGCCTGGTGTGGGCCATCCCAGG - Intergenic
1007821256 6:44561915-44561937 CACCTGGTGTGGGACCTGGAAGG - Intergenic
1014815227 6:125928022-125928044 ATCCTGGTGTGGGCCAGGTCTGG + Intronic
1018542794 6:164901016-164901038 CTCAAAGTGTGGGCCCTGGCTGG - Intergenic
1019136154 6:169909089-169909111 TCCCTGGTGTGGGACCCAGCGGG - Intergenic
1019323100 7:424533-424555 TTCCTGGGGTGACTCCTGGCTGG - Intergenic
1020245251 7:6424435-6424457 TCCCGGGTGTGGGGCCTGGCTGG + Intronic
1020628610 7:10613780-10613802 TTGCTGTTGTGGGCCCAGGCTGG + Intergenic
1022017010 7:26358834-26358856 TTGCTGTTGTTGGCCCGGGCTGG + Intronic
1022396130 7:29989481-29989503 TTCCCGGTGCTGGCCCGGGCGGG - Intronic
1022465506 7:30650483-30650505 TTCCTGGTGTTGGCCTTGGCAGG + Intergenic
1023882830 7:44330128-44330150 TGCCTTGTGTTAGCCCTGGCTGG - Intronic
1024727173 7:52211501-52211523 TTCCTGGTGAGGGCACTGGAGGG - Intergenic
1024996576 7:55277178-55277200 GTTCTGGCGTGGGCCCTGCCTGG - Intergenic
1025256431 7:57386633-57386655 TCCTTCATGTGGGCCCTGGCAGG - Intergenic
1032344414 7:131106109-131106131 TTCCGGGAGCGGGCGCTGGCGGG - Intergenic
1033934419 7:146566094-146566116 TTGCTGGTGTAGGCTCTGGGAGG + Intronic
1035047112 7:155974724-155974746 TTCCCAGTGTGGACCCTGGTCGG - Intergenic
1035401555 7:158569541-158569563 TTCCTGGTGAGGGGCCCAGCAGG - Intronic
1035492961 7:159295964-159295986 TTCCTGGTCTGGGCTCTAGGAGG + Intergenic
1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG + Intronic
1036632336 8:10524568-10524590 TTGCTGGTGTGTGCCCTCCCTGG - Intergenic
1037805275 8:22055237-22055259 CTCCTGGGGTGGGGCCTGGTGGG + Intronic
1041324290 8:56648622-56648644 GTCATGGTGTGGGCCTTGTCAGG - Intergenic
1045268835 8:100644488-100644510 TTCCTGCTGTGTGAACTGGCTGG - Intronic
1045699461 8:104849824-104849846 GCCCTGGTGTGGGGGCTGGCTGG + Intronic
1045735612 8:105293183-105293205 TTCCTGGTTTGGGCTCTCTCTGG - Intronic
1048353441 8:133634501-133634523 TTCCTCCTGTGGGCTCTGGACGG + Intergenic
1049360484 8:142210446-142210468 TCCCCGGGGTGGGCCCTGGGTGG - Intergenic
1049475142 8:142793835-142793857 GTCCTGGTGAGTTCCCTGGCAGG - Intergenic
1049741402 8:144242792-144242814 TCCCTGGCCTGGGCCCTGGACGG + Intronic
1053000318 9:34574185-34574207 TCCCTGGTGAGGGGCCTGCCGGG - Intronic
1053288001 9:36862273-36862295 TTCCTGGTGTGTGGCCAGACAGG - Intronic
1053415865 9:37946468-37946490 TTCCTTGTGTGCTCCCTGGTTGG + Intronic
1053633182 9:39966350-39966372 TTCCTTCTGTGGATCCTGGCAGG + Intergenic
1053772566 9:41497183-41497205 TTCCTTCTGTGGATCCTGGCAGG - Intergenic
1054210706 9:62284347-62284369 TTCCTTCTGTGGATCCTGGCAGG - Intergenic
1054314277 9:63564507-63564529 TTCCTTCTGTGGATCCTGGCAGG + Intergenic
1056740041 9:89246487-89246509 CTCCAGGTGTGGGCCATGACTGG + Intergenic
1057049950 9:91915972-91915994 TTCCTGGCTTAGGCTCTGGCAGG + Intronic
1057230274 9:93317612-93317634 TACCTGGTGTGGGCACGGACAGG - Exonic
1057550482 9:96048331-96048353 TTCCTGGTGTCAGTCATGGCCGG + Intergenic
1058644357 9:107116814-107116836 TCCCTGGTCTGGGCCATGTCTGG + Intergenic
1058670401 9:107356433-107356455 TTCCTGGTGAGGGCTCTCTCTGG - Intergenic
1060148624 9:121272241-121272263 TTGCTGATGTGGTCCCAGGCAGG - Intronic
1060603062 9:124890728-124890750 GCCTTGGTGTGGGTCCTGGCGGG - Intronic
1060780442 9:126408447-126408469 TGCCTGCAGTGGGCCCAGGCAGG + Intronic
1060796096 9:126514087-126514109 TCCCTAGGGTGGGTCCTGGCAGG + Intergenic
1061092464 9:128434288-128434310 TTCCTGCTTGGGACCCTGGCCGG + Intronic
1061246571 9:129403832-129403854 TACCTGGGCTGGCCCCTGGCTGG + Intergenic
1061917554 9:133763169-133763191 CTCCTGGAGAGGGACCTGGCAGG + Exonic
1062378824 9:136277028-136277050 ATCCTGGAGTTGGTCCTGGCCGG - Intergenic
1062471824 9:136709519-136709541 TTCATGGAATGGGCACTGGCCGG - Intergenic
1062542875 9:137049277-137049299 TTCCAGGCATGGGCGCTGGCTGG - Intronic
1062657865 9:137613505-137613527 TTCCTGGTGAGAGCCCAGCCTGG + Exonic
1189027168 X:37407855-37407877 ACCCTTGTGTGGGCCCTGGTAGG + Intronic
1189470657 X:41311438-41311460 TTCATGCTTTGGGCACTGGCGGG - Intergenic
1190765520 X:53472853-53472875 TGCCTGGTGTGGGAACTGCCAGG + Intergenic
1197771460 X:130092173-130092195 TGTCTGCTGTGGGCCCTGGGAGG - Intronic
1198618145 X:138480575-138480597 TTCCTGCTGTCAGCCCTGGGAGG + Intergenic
1199786959 X:151114424-151114446 TGGCTGGGGTGGGCGCTGGCAGG + Intergenic
1199809938 X:151339224-151339246 TGCCTGGTGTGTGCCCAGGTGGG + Intergenic
1200078885 X:153565914-153565936 TGCCTGCTGTGGGCACTGCCTGG + Intronic
1200384357 X:155874806-155874828 TTTCTGATGAGGGCCCTGGGAGG + Intergenic