ID: 1122904036

View in Genome Browser
Species Human (GRCh38)
Location 14:104793843-104793865
Sequence CTTCCAGATGGGCCTTCCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122904029_1122904036 26 Left 1122904029 14:104793794-104793816 CCAGAAAGAGCACTTCGCATGCT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1122904030_1122904036 0 Left 1122904030 14:104793820-104793842 CCTGTGAGCAGTCCTCTGCTACC 0: 1
1: 0
2: 2
3: 9
4: 153
Right 1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1122904028_1122904036 27 Left 1122904028 14:104793793-104793815 CCCAGAAAGAGCACTTCGCATGC 0: 1
1: 0
2: 0
3: 1
4: 100
Right 1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG 0: 1
1: 0
2: 1
3: 24
4: 306
1122904027_1122904036 28 Left 1122904027 14:104793792-104793814 CCCCAGAAAGAGCACTTCGCATG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG 0: 1
1: 0
2: 1
3: 24
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122904036 Original CRISPR CTTCCAGATGGGCCTTCCTG AGG Exonic
902387445 1:16083798-16083820 CTTCGAGATGTTCCTTCCTAGGG + Intergenic
902684756 1:18068817-18068839 CCTCAAGAAGGGCATTCCTGGGG + Intergenic
902909874 1:19587784-19587806 TTACCAGGTGGGCCTTTCTGTGG - Intergenic
903659029 1:24965743-24965765 CACCGAGAAGGGCCTTCCTGTGG + Intergenic
904035819 1:27558036-27558058 CTTCCAAAGGAGCATTCCTGGGG - Intronic
904914406 1:33959635-33959657 CTTCCATAGGGGCCTTCAGGTGG + Intronic
905482008 1:38268236-38268258 CTTCCAGATGCCCTTTCCTCTGG - Intergenic
908156835 1:61362118-61362140 CTGCCAGATGGTCCTTTTTGGGG + Intronic
908540882 1:65120919-65120941 CTTCTAGCTGTGTCTTCCTGTGG - Intergenic
909765181 1:79346956-79346978 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
910667134 1:89737990-89738012 CCTCCCGAAGGACCTTCCTGAGG + Intronic
911178843 1:94843391-94843413 CTTCCATCTGGGCTTTTCTGAGG - Intronic
911273509 1:95832111-95832133 CTTCCTGATGTCCCTTTCTGTGG - Intergenic
911545315 1:99209190-99209212 CTTCCTGAAGGACTTTCCTGGGG + Intergenic
921141548 1:212311625-212311647 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
922573668 1:226648037-226648059 CTTCCAGAGGGTCCTACATGTGG + Intronic
922630184 1:227099272-227099294 CTTCCTGAAGGACCTGCCTGAGG - Intronic
922796593 1:228342591-228342613 CTTCCAGTTGTCCCCTCCTGGGG + Intronic
924245136 1:242076352-242076374 CTTCCAGATGAAACCTCCTGAGG - Intergenic
1063262844 10:4409785-4409807 CTTCCAGATGAGACATCTTGTGG - Intergenic
1063612669 10:7576368-7576390 CTTCCTGCTGGGGCTTCCTGTGG + Intronic
1063907336 10:10794823-10794845 ATTCCAGGTGGGCTTTCATGTGG - Intergenic
1065631106 10:27681954-27681976 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
1066757798 10:38728405-38728427 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1067826213 10:49575244-49575266 CCTCCAGAAGGCCCTGCCTGAGG + Intergenic
1068756091 10:60655243-60655265 CTTCCAGAAGGACCTGCCTGAGG - Intronic
1068912471 10:62393193-62393215 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1070591571 10:77805612-77805634 TCTCCAGATGGGGCTTGCTGTGG - Intronic
1070986622 10:80695178-80695200 CTTTCAGAGGTGCCTTCCTGTGG + Intergenic
1072325154 10:94290631-94290653 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1072744618 10:97931261-97931283 CTGCCAGATTGTCCTTCCTAGGG - Intronic
1072800805 10:98391067-98391089 CTTCCAGGAGTGGCTTCCTGAGG - Exonic
1072998112 10:100264643-100264665 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1073353435 10:102835713-102835735 CATCCAGAGTTGCCTTCCTGTGG - Intronic
1073434823 10:103510069-103510091 CTTCTAGAGGAGACTTCCTGGGG + Intronic
1074720223 10:116257445-116257467 CTTCCAGTTGCACCTTCTTGAGG - Intronic
1075075704 10:119348933-119348955 CTTCAAGAGCGGCCCTCCTGTGG - Intronic
1075787689 10:125061256-125061278 CTTCCCGATAGGACTTCCAGTGG + Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1077341075 11:2026628-2026650 CTTCCTGATGCCCCTGCCTGGGG + Intergenic
1077359442 11:2134214-2134236 CTTCCAGCTGAGCATTGCTGTGG - Intronic
1077564595 11:3289479-3289501 CTTCCAGAGGGGCCTCTGTGTGG + Intergenic
1077570484 11:3335296-3335318 CTTCCAGAGGGGCCTCTGTGTGG + Intergenic
1078548635 11:12264625-12264647 CCTCCAAATGGGTGTTCCTGAGG + Intergenic
1080457364 11:32429229-32429251 CTTCCAGTTGGGCCTTCAGATGG + Intronic
1080480565 11:32645232-32645254 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1080539366 11:33252197-33252219 ATTCCAGTTGCCCCTTCCTGAGG + Intergenic
1081596311 11:44462028-44462050 CTTCCAGGTGGCCTCTCCTGGGG + Intergenic
1081766049 11:45610787-45610809 CCTCCTGATGGGGCTGCCTGTGG - Intergenic
1084861560 11:72021945-72021967 CTTCCAGATGACCCTACCAGAGG + Intronic
1084927897 11:72528390-72528412 CTTCCAAAGGGGCTTTCCAGAGG + Intergenic
1085405383 11:76258688-76258710 CTTCCAGATAAGCCTTTCTTGGG - Intergenic
1087819703 11:102698020-102698042 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
1088336507 11:108710606-108710628 CTTCCTGAGGGACCTGCCTGAGG + Intronic
1088553127 11:111035090-111035112 CTTCCAGGAGGACTTTCCTGTGG + Intergenic
1088993972 11:114979948-114979970 CCTCTTGATGGGCCTGCCTGGGG - Intergenic
1089286437 11:117410888-117410910 CTGCCAGGTGAGCCTCCCTGGGG + Exonic
1089322833 11:117638070-117638092 CTTCAAGCTGGGCTCTCCTGGGG + Intronic
1090093343 11:123719447-123719469 CTTCCTGAAGGATCTTCCTGAGG + Intergenic
1202824060 11_KI270721v1_random:81817-81839 CTTCCTGATGCCCCTGCCTGGGG + Intergenic
1091632027 12:2169452-2169474 CTTAGACTTGGGCCTTCCTGAGG - Intronic
1091745035 12:2986273-2986295 CCTCCCGAAGGGCCTGCCTGAGG + Intronic
1094561717 12:31560693-31560715 CTTCATGATGGGGCCTCCTGTGG + Intronic
1096524299 12:52201341-52201363 TCTCCAGCTGGGGCTTCCTGAGG - Intergenic
1097649426 12:62278274-62278296 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1100732326 12:97485853-97485875 CTGCCAGGTGGGCCTACATGTGG - Intergenic
1101737838 12:107476199-107476221 CCTCCTGATGAGGCTTCCTGGGG + Intronic
1103323076 12:120102795-120102817 CTTCCTCATTCGCCTTCCTGAGG + Intronic
1103816034 12:123657316-123657338 CTTCCAGATGCTGCTTGCTGAGG + Intronic
1109484654 13:63002483-63002505 CCTAAGGATGGGCCTTCCTGAGG - Intergenic
1110144162 13:72169040-72169062 CTTCCAGAGGGGCCTGGATGAGG + Intergenic
1110725373 13:78816838-78816860 CCTGCAGCTGGGCCTCCCTGTGG - Intergenic
1111421401 13:88016371-88016393 CTTCCTGAAGGACCTGCCTGCGG - Intergenic
1112382483 13:98905441-98905463 CTTCCAAATGGGCCTTCCCTTGG - Intronic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1114856857 14:26457738-26457760 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1115210405 14:30961965-30961987 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1117873805 14:60228952-60228974 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1118631240 14:67705476-67705498 CTTCCAAATTAGCCTACCTGGGG - Intronic
1119210168 14:72825627-72825649 CTTCCCCAGGGGCCTTCTTGAGG - Intronic
1121045791 14:90786432-90786454 GTTCCAGAAGGACCTTGCTGGGG - Intronic
1121775355 14:96587207-96587229 TTACCTGATGGGCTTTCCTGAGG + Intergenic
1121894266 14:97630990-97631012 CTTTCAGAGGAGCCTTCCTCCGG - Intergenic
1122235965 14:100330760-100330782 CTTCCAGAGGGGGCTGCCCGTGG + Intergenic
1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG + Exonic
1124552379 15:30693443-30693465 ATTCCAAAGGGTCCTTCCTGGGG - Intronic
1124665908 15:31592542-31592564 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1124678860 15:31712223-31712245 ATTCCAAAGGGTCCTTCCTGGGG + Intronic
1126624418 15:50672391-50672413 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1127629555 15:60814392-60814414 TTTCCAGATGGAGCTTCCTGAGG + Intronic
1128509991 15:68307501-68307523 CTTCCACCTGGGGCTGCCTGGGG - Intronic
1129987503 15:79931348-79931370 CCTCCAGATGTGCCTCCCTCTGG + Intergenic
1130395163 15:83494981-83495003 CTTCCAGATGCTCCTTCCCTTGG + Intronic
1131140378 15:89972288-89972310 CTGCCCCATGGGCCCTCCTGAGG - Intergenic
1131154768 15:90067932-90067954 GATCCAGCTGGGCCTTCTTGTGG - Exonic
1132335909 15:101048652-101048674 CTTCCAGGTGTTCCTACCTGAGG - Exonic
1132609726 16:809390-809412 TTTCCAGAGGAGCCTGCCTGGGG - Intronic
1133211146 16:4264032-4264054 CTTCCTGAGGGGCCCTCCCGGGG + Intronic
1133232590 16:4373551-4373573 GTGCCAGAGGGGCCTTCCTCGGG - Intronic
1135965493 16:27031687-27031709 CTTCAGGAAGGGACTTCCTGGGG - Intergenic
1136720019 16:32312425-32312447 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1136725072 16:32350819-32350841 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1136838396 16:33518704-33518726 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1136843399 16:33556872-33556894 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1139975347 16:70805519-70805541 CTCCTAGATCGGACTTCCTGAGG + Intergenic
1140308121 16:73822764-73822786 CTTCCAGCTGGGGCTTCTTCTGG - Intergenic
1140489545 16:75323397-75323419 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1141766839 16:86064433-86064455 CTTCCAGGTGGGACTGCCTCTGG - Intergenic
1141954300 16:87359949-87359971 CTTCAGGATGGGACTGCCTGTGG - Intronic
1142032659 16:87846273-87846295 CTTCCAGGCTGGCCTGCCTGTGG - Intronic
1142341196 16:89523913-89523935 CGTCCAGCTGAGCTTTCCTGAGG + Intronic
1203001358 16_KI270728v1_random:166935-166957 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1203006412 16_KI270728v1_random:205344-205366 CTTCCTGAAGGACCTACCTGAGG - Intergenic
1203132961 16_KI270728v1_random:1703339-1703361 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1203148560 16_KI270728v1_random:1818989-1819011 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1203153564 16_KI270728v1_random:1857170-1857192 CTTCCTGAAGGACCTACCTGAGG + Intergenic
1142993305 17:3746288-3746310 CTTCCAGCTGTGCCGTCCTGGGG - Intronic
1144632241 17:16880196-16880218 CTTCCAGCTGGGCTTCCCAGAGG - Intergenic
1144723585 17:17489162-17489184 CTTGCAGAGGGGCCTCCCTGTGG + Intronic
1146078047 17:29751066-29751088 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1147185592 17:38711567-38711589 CCTCCACCTGGGCCTTGCTGGGG + Intronic
1148229604 17:45923417-45923439 CTTCCAGGGTGCCCTTCCTGGGG - Intronic
1148920520 17:51027859-51027881 CTTCCTGAAGGACCTACCTGAGG - Intronic
1151316455 17:73325417-73325439 GTCCCAGAGGGGCCGTCCTGGGG + Intergenic
1152051776 17:77984680-77984702 CTCCCAGTAGGGCCCTCCTGTGG + Intergenic
1152240809 17:79160029-79160051 CTGCCTGTTGGCCCTTCCTGGGG - Intronic
1152708677 17:81859372-81859394 CTTCCAGATGCCCCTTGGTGTGG - Exonic
1152775130 17:82196473-82196495 CGTCATGATGGGCCCTCCTGTGG - Intronic
1152836112 17:82533113-82533135 CTTCCTGAAGGACCTACCTGGGG + Intronic
1153158945 18:2180950-2180972 CTTGCAGTTGGGCCTTCTTTGGG - Intergenic
1153610388 18:6878757-6878779 CTTTCACATTGGCCTTCCTAGGG - Intronic
1153711228 18:7801493-7801515 CCTCCCGATGGACCTACCTGAGG + Intronic
1156115669 18:33784598-33784620 CTTCCATTTGGTCCTTTCTGGGG - Intergenic
1156492396 18:37503977-37503999 CTTCCAGAGAGCCCCTCCTGGGG + Intronic
1157075170 18:44457937-44457959 CTTGCAGATGTACCTCCCTGGGG - Intergenic
1160090405 18:75821443-75821465 CATCCAGATGTGCCTTTCTTTGG - Intergenic
1160222552 18:76988116-76988138 CTTCCACATGCGGGTTCCTGGGG + Intronic
1160390553 18:78528122-78528144 CTTCCACATGGGCCTGCCCAGGG + Intergenic
1161308074 19:3578231-3578253 CTCCCGGAGGGGCCTACCTGCGG + Intronic
1162698655 19:12496785-12496807 AGCCCAGATGGGTCTTCCTGGGG + Intronic
1163529739 19:17842396-17842418 CTTCCACGTGGGCCTCCCTGGGG - Exonic
1164603133 19:29577196-29577218 CTTCCGGAAGGACCTGCCTGCGG - Intergenic
1164802185 19:31086609-31086631 CTTCCGGAAGGACCTGCCTGAGG + Intergenic
1165779139 19:38422137-38422159 ATTCCTGGTGGGACTTCCTGTGG + Exonic
1165863452 19:38921580-38921602 CCTCAAGCTGGGCCTCCCTGGGG + Exonic
1166965758 19:46528611-46528633 CTTCCAGAGGGGTGTTCCTAAGG + Intronic
1167503333 19:49859155-49859177 CTTCCAGCTGGGCCATACTTGGG + Intronic
1168399176 19:56074154-56074176 CCTCCAGAAGGACCTGCCTGAGG + Intergenic
926648114 2:15312080-15312102 CTGCCAGATAGGCCTGCCTTTGG + Intronic
927277721 2:21275721-21275743 CTTCCTGATGGAGCTCCCTGGGG + Intergenic
928437542 2:31265143-31265165 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
928696590 2:33855682-33855704 CTTCTAGATGTGTCATCCTGTGG - Intergenic
929478818 2:42282047-42282069 TTTCCAGATAGGCCTTCTTTTGG + Intronic
930892808 2:56410824-56410846 CTTCCTGAAGGACCTACCTGAGG + Intergenic
931052574 2:58429932-58429954 ATTCCAGATGGGCCTTCCACAGG - Intergenic
933410119 2:81914992-81915014 CTTCCTGAAGGGTCTGCCTGAGG + Intergenic
933653043 2:84864603-84864625 CTTCCAGATGGGCCTCTCTCGGG + Intronic
934321108 2:91972846-91972868 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
935779834 2:106501136-106501158 CTTACAAAGGTGCCTTCCTGAGG - Intergenic
938343206 2:130549026-130549048 CTTCCCGGTGGGCCTCCCGGAGG + Intronic
938346627 2:130571696-130571718 CTTCCCGGTGGGCCTCCCGGAGG - Intronic
938398468 2:130967879-130967901 CTTCCAGGTGTCCCCTCCTGTGG + Intronic
939516623 2:143176909-143176931 CTTCCACATGGGCCTTTCCATGG + Intronic
940283638 2:152012130-152012152 CCTCCAGAAGGACCTGCCTGAGG - Intronic
940396791 2:153198982-153199004 CTTCCAGATGGGACACCCTATGG + Intergenic
942049155 2:172122533-172122555 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
942631468 2:177954661-177954683 ATTCCAGAATGGCCTTACTGGGG - Intronic
943563268 2:189488517-189488539 CTTCCCAAAGGACCTTCCTGAGG - Intergenic
943769316 2:191697963-191697985 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
946941627 2:224775355-224775377 CTTCCAGATGTGCCTGGCTGTGG + Intronic
947038122 2:225883312-225883334 CCTCCAGAAGGACCTGCCTGAGG - Intergenic
948270485 2:236669917-236669939 CTCCCAGATGTGCCTTGCTTAGG + Intergenic
1170515463 20:17125196-17125218 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1172059832 20:32179737-32179759 CTTCCTGATGGGCCTTTCCTTGG + Intergenic
1172738314 20:37145773-37145795 CCTCCTGAAGGGCCTGCCTGGGG + Intronic
1173249522 20:41357283-41357305 CTTCCTGGTGGGCCATCCTGGGG + Intronic
1173994860 20:47330122-47330144 CTTCCAGACTGACCTTCGTGAGG - Intronic
1174191025 20:48740516-48740538 CTTCCAGATGGGACTATCAGTGG + Intronic
1175515698 20:59568495-59568517 CCTCCAGATGGGCCATCCTCAGG + Intergenic
1175843078 20:62042810-62042832 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1176669915 21:9723609-9723631 CTTTCCTATGGGCCTTTCTGAGG + Intergenic
1177043235 21:16138708-16138730 CCTCCTGATGGACCTGCCTGAGG - Intergenic
1178750747 21:35300628-35300650 CTGCCACATGGGCCTTCCCATGG - Intronic
1180309350 22:11156818-11156840 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1180547827 22:16518629-16518651 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1182211630 22:28681740-28681762 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1182596229 22:31422872-31422894 CTTACAGATGGGACTTCATATGG + Intronic
1183964086 22:41430916-41430938 CCTCCTGATGGGGCTCCCTGGGG + Intergenic
1184468332 22:44681905-44681927 CTTCCACATTGGCCTCCCTGTGG - Intronic
1185003820 22:48263451-48263473 CTTCCTGAAGGCCCATCCTGCGG - Intergenic
949158810 3:857017-857039 GTTCCTGATGTTCCTTCCTGAGG - Intergenic
949510412 3:4761989-4762011 ATTCCAGAAGGCCCTCCCTGAGG + Intronic
949851534 3:8425526-8425548 CTTCAGGATGAGCCTTCCTCTGG - Intergenic
950648418 3:14392338-14392360 TTCCCAGAGGGGCCCTCCTGTGG + Intergenic
952741423 3:36738314-36738336 CTTCCAGAGTGGCTTCCCTGGGG + Exonic
953098335 3:39801136-39801158 GTTCCAGATGCCCTTTCCTGGGG + Intergenic
953452181 3:43014517-43014539 CTTCCCAATGCCCCTTCCTGTGG - Intronic
954631786 3:52051732-52051754 CTTCCAGAGGAGCCTCCCTCAGG - Intronic
955138437 3:56244423-56244445 CTTCCTGAGGGACCTGCCTGAGG - Intronic
956139636 3:66132429-66132451 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
956184849 3:66552644-66552666 CTTCAAGATCGGACTCCCTGGGG + Intergenic
956811455 3:72867652-72867674 CTCCCAGTTTGGCCTTCCTCAGG + Intergenic
957080364 3:75631562-75631584 CTGCCAGCTGGGCCTTCCCAGGG + Intergenic
958979443 3:100704263-100704285 CTTGCAAGTGGGCCTTTCTGAGG + Intergenic
959060183 3:101609490-101609512 CTTCCTGAAGGACCTACCTGAGG - Intergenic
959396911 3:105852145-105852167 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
959652587 3:108765726-108765748 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
962075137 3:132073681-132073703 CTCCCAGATGACCCTTTCTGTGG + Intronic
962495070 3:135931338-135931360 CCTCCTGACGGACCTTCCTGAGG - Intergenic
964749859 3:160044260-160044282 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
967917986 3:194592995-194593017 CTTCCAGGAGGGACTTCCTATGG - Intronic
968255722 3:197269043-197269065 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
968630725 4:1649634-1649656 TTGCCACATGGGCCTCCCTGAGG - Intronic
968779654 4:2570839-2570861 CTCACAGATGGGCCTTACTCAGG + Intronic
969088793 4:4676855-4676877 CTTGTAGTTGGGCTTTCCTGGGG + Intergenic
969148608 4:5146537-5146559 GTTGCAGGTGGGTCTTCCTGAGG + Intronic
970889060 4:21021759-21021781 CCTCCTGAAGGGCCTCCCTGAGG + Intronic
971116623 4:23654146-23654168 CTTCCTAAAGGGCCTGCCTGAGG + Intergenic
971383682 4:26123889-26123911 CTTCCAGAAGTACCTTCCTGAGG + Intergenic
973217751 4:47689853-47689875 TCTGCAGATGGGGCTTCCTGAGG + Intronic
973780218 4:54281795-54281817 CTTCCAGATGGGACTAACTGGGG + Intronic
973952449 4:56030223-56030245 CTTCCTGAAGGACCTGCCTGAGG + Intronic
974507137 4:62790240-62790262 CTCTCACATGGGCCTTCCTTTGG - Intergenic
976006387 4:80435689-80435711 CTTCCAGATGGGCCTTACCAAGG + Intronic
977412266 4:96683113-96683135 CTTCCAGACATGCCTGCCTGTGG - Intergenic
978874709 4:113625521-113625543 CTTCCATATGGTCTTCCCTGAGG - Intronic
979104756 4:116669658-116669680 CTTCCAGATAGGCTTTCATTAGG - Intergenic
981927456 4:150155571-150155593 CCTCCAGAGGGGACTCCCTGAGG - Intronic
982154567 4:152505710-152505732 CCTCCTGAAGGGCCTTCTTGAGG + Intronic
984868641 4:184307918-184307940 CCTCCTGATGGGCCTGCCTGAGG + Intergenic
984874728 4:184357003-184357025 CTGGGAGATGGTCCTTCCTGTGG + Intergenic
985138079 4:186809316-186809338 CCTCCTGAAGGGCCTGCCTGAGG + Intergenic
985152224 4:186959292-186959314 CTTCCTCATGTGCCGTCCTGGGG - Intergenic
985404867 4:189627922-189627944 CTTTCCTATGGGCCTTTCTGAGG - Intergenic
986007193 5:3677914-3677936 CTTCCAGGAGGGCCCTGCTGAGG - Intergenic
986202017 5:5587612-5587634 CATCCAGAGGTCCCTTCCTGTGG + Intergenic
986300794 5:6476964-6476986 CTTCCATGTGGGCCATCCTGGGG - Intronic
987478574 5:18423925-18423947 CTTCCAGAAGTACCATCCTGAGG + Intergenic
987857189 5:23435736-23435758 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
990806428 5:59667834-59667856 ATTCAAGATGGATCTTCCTGCGG + Intronic
992407972 5:76477684-76477706 CCTCCAAAAGGGCCTGCCTGGGG - Intronic
992614189 5:78534021-78534043 CTCCTTGCTGGGCCTTCCTGTGG - Intronic
994633281 5:102312715-102312737 CTTCCATATGAGCTGTCCTGTGG + Intergenic
995885557 5:116890476-116890498 CTACAGGATGGGCCTTTCTGTGG + Intergenic
996238091 5:121158811-121158833 CCTCCAGATGGGCCTGCATCAGG + Intergenic
996428610 5:123344142-123344164 CTACCAGAGGGCCCTTCCTATGG + Intergenic
997017859 5:129958337-129958359 ATTCCAGCTGGGCCTTTCTTGGG + Intronic
997390436 5:133510729-133510751 CTTCCAGAAAGGACTCCCTGGGG - Intronic
997807579 5:136934319-136934341 CTTGCAGATGGCCTATCCTGGGG + Intergenic
998397728 5:141829854-141829876 TTTCCAGATGGGCCAGTCTGAGG - Intergenic
1000711275 5:164582095-164582117 TTTCCAGATGGCCCTTCATTTGG + Intergenic
1002201405 5:177530799-177530821 CTGCCAGGAGGGCCCTCCTGAGG + Intronic
1002395208 5:178947063-178947085 CTTGCAGATGCACCTGCCTGAGG + Intronic
1003980912 6:11388942-11388964 CTTCCAGCTGGGTCTGCATGTGG - Intergenic
1004524714 6:16396059-16396081 CCTCCAGAGGGACCTGCCTGAGG - Intronic
1007548559 6:42711618-42711640 CTTCAAATTGGGGCTTCCTGAGG - Intronic
1007997636 6:46325542-46325564 CTTCCAGATGGATATTGCTGTGG + Intronic
1009979551 6:70711052-70711074 CCTCCTGAAGGGCCTACCTGAGG + Intronic
1013411017 6:109883362-109883384 CTTCCTGAAGGTCCTGCCTGAGG + Intergenic
1015721166 6:136243748-136243770 CCTCCTGAAGGACCTTCCTGAGG - Intronic
1015974746 6:138778526-138778548 GTTCCAAAAAGGCCTTCCTGAGG + Intronic
1016581272 6:145631227-145631249 CATCAAGATGAACCTTCCTGGGG - Intronic
1016891864 6:149015057-149015079 GTTCCAGAGAGTCCTTCCTGAGG - Intronic
1017669266 6:156754680-156754702 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1018041601 6:159928875-159928897 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1019362259 7:610990-611012 ATTCCAGCCGGCCCTTCCTGCGG + Intronic
1019633461 7:2062795-2062817 GTTCCAGTTTTGCCTTCCTGCGG - Intronic
1020551491 7:9611768-9611790 CATTGACATGGGCCTTCCTGGGG - Intergenic
1021620943 7:22550425-22550447 AGTGCAGATGCGCCTTCCTGTGG - Intronic
1021861518 7:24910680-24910702 CTACCAGATGGCCCACCCTGGGG - Intronic
1022316395 7:29249139-29249161 CTTGCAGATGGGCTGTCATGGGG - Intronic
1023043629 7:36193630-36193652 CCTTCAGATGGCCCTGCCTGTGG + Intronic
1023090763 7:36615502-36615524 CCTGCAGTTGGGGCTTCCTGTGG - Intronic
1023308683 7:38858905-38858927 CCTCCAGAAGGACCTGCCTGAGG - Intronic
1023615214 7:42012877-42012899 CTTCCTGGTGGCCTTTCCTGGGG - Intronic
1024269371 7:47630644-47630666 CTTCCTGAAGGGCCTGCCTGGGG - Intergenic
1026603992 7:71800330-71800352 CTTCCCCAGGGGGCTTCCTGGGG + Intronic
1026903852 7:74051606-74051628 TCTCCAGATGGGCCTGTCTGGGG - Intronic
1026978913 7:74515435-74515457 CTTCCACGGGGGCCCTCCTGTGG - Exonic
1027442128 7:78230832-78230854 TTTCCTGATGTGCCTTCCTCAGG + Intronic
1028977238 7:96927561-96927583 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1029439473 7:100579021-100579043 CGTCCGGATGGGCCTTCCCGGGG - Intronic
1030276352 7:107725775-107725797 CTTCCCGAGTGGCCTTCCTTAGG - Intergenic
1030522933 7:110620594-110620616 CTTCCAGACAGCCCTTACTGTGG + Intergenic
1031110896 7:117607207-117607229 CTTCCTTATGGTCCTTACTGTGG - Intronic
1032094066 7:128928968-128928990 CTTCCACAGGGGCCTGACTGAGG + Intergenic
1034968633 7:155406112-155406134 CTTCCTGCTGGGGCGTCCTGTGG - Intergenic
1035333694 7:158112587-158112609 CTCCCAGCTGGGCCTTCCTGGGG - Intronic
1035670534 8:1413812-1413834 CTGCCAGGTGGGCCTTGGTGAGG + Intergenic
1036021236 8:4848969-4848991 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1036444974 8:8813376-8813398 CCTCCCGAAGGGCCTGCCTGAGG - Intronic
1036643268 8:10597232-10597254 CTTCCAGATGTTTCTGCCTGAGG - Intergenic
1037558167 8:20046860-20046882 CTTTCATTTGGGCCTACCTGGGG + Intergenic
1037735695 8:21564214-21564236 CTTCCAGATGGTTCTTCCCATGG + Intergenic
1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG + Intronic
1039795227 8:40907192-40907214 ATTCCAGCTAGGACTTCCTGTGG - Intergenic
1040764120 8:50886098-50886120 CTTCCTGAAGGACCTTCCTGAGG + Intergenic
1040776405 8:51048892-51048914 CTTTCAGATGGGCATTGCAGTGG + Intergenic
1041193601 8:55377829-55377851 TTTCCAGAAGTGCCTTTCTGGGG - Intronic
1041505884 8:58596984-58597006 CTTCCAGAAGGGACTTTCTCTGG - Intronic
1043997780 8:86840392-86840414 CTTCCACATTTGCCTTCATGGGG + Intergenic
1045436010 8:102165187-102165209 CTTCTAGATGGCCTGTCCTGTGG - Intergenic
1046764375 8:118053947-118053969 CTGCCAGATGTGCCTTGGTGGGG - Intronic
1047415887 8:124664094-124664116 CTTCCAGCTGCTCCCTCCTGGGG - Intronic
1048070229 8:131013186-131013208 CTTCCCAATGGGACATCCTGTGG + Intronic
1048236046 8:132691839-132691861 CAGCCACATGGGCCTTCCTCTGG - Intronic
1049068350 8:140337590-140337612 CATCCAGATGCGCCTCCCTCCGG + Intronic
1049356088 8:142189080-142189102 CTCCCTTATGGGCCTTCATGGGG - Intergenic
1052456105 9:28700156-28700178 TTTACAGCTGGGCCTTCCAGGGG - Intergenic
1052744654 9:32428453-32428475 CTTCCTGAAGAACCTTCCTGAGG + Intronic
1055641692 9:78323918-78323940 CTTTCAGAGGGGCCTGACTGTGG + Intronic
1056432030 9:86537385-86537407 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1059035778 9:110752229-110752251 ATTCCAGAGGGACCTTCATGGGG - Intronic
1060868367 9:127018269-127018291 CTTCCGGAAGGACCTGCCTGAGG + Intronic
1060987478 9:127828156-127828178 CTTCTAGATGGGCCATTCTAGGG - Intronic
1061790928 9:133058453-133058475 ATTCCAGAGGGGCCTGGCTGTGG - Exonic
1062308361 9:135922055-135922077 CTACCAGCTGGGCCATCCTGGGG - Intergenic
1203759002 EBV:2308-2330 CTTCCAGAGGGCCCTTCTGGTGG + Intergenic
1186221067 X:7349882-7349904 CTTCCAGATGGATGTGCCTGTGG - Exonic
1187762274 X:22601069-22601091 CCTCCTGATGGACCTGCCTGAGG - Intergenic
1191023590 X:55889345-55889367 CTTCCAGATGAAACTTCCAGAGG - Intergenic
1191807043 X:65147288-65147310 GTACCAGATCAGCCTTCCTGAGG - Intergenic
1192710337 X:73576155-73576177 CTTCTAAAAGGGCCTGCCTGAGG + Intronic
1194496766 X:94625655-94625677 CCTCCCGATGGACCTGCCTGAGG + Intergenic
1197699858 X:129591184-129591206 GCTCTAGATGGGCCTGCCTGAGG - Exonic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199528293 X:148817505-148817527 CTCCCAGATGGGATTTCGTGAGG + Intronic
1200034516 X:153319082-153319104 CTCCCAGCTGGGACCTCCTGGGG + Intergenic
1200928030 Y:8671959-8671981 TTCCCAAATGGGGCTTCCTGTGG + Intergenic
1200964720 Y:9025626-9025648 CTCCCGGATGTGGCTTCCTGTGG - Intergenic
1201188595 Y:11427968-11427990 CTTCCTGAAGGACCTGCCTGAGG - Intergenic