ID: 1122904062

View in Genome Browser
Species Human (GRCh38)
Location 14:104793933-104793955
Sequence GGCTGTGGAAAGACCCATGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122904062_1122904066 12 Left 1122904062 14:104793933-104793955 CCAACATGGGTCTTTCCACAGCC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1122904066 14:104793968-104793990 CTCCCCCCAGGCCACCTTTCTGG 0: 1
1: 0
2: 2
3: 20
4: 281
1122904062_1122904075 27 Left 1122904062 14:104793933-104793955 CCAACATGGGTCTTTCCACAGCC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1122904075 14:104793983-104794005 CTTTCTGGCCTCCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 131
1122904062_1122904076 28 Left 1122904062 14:104793933-104793955 CCAACATGGGTCTTTCCACAGCC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1122904076 14:104793984-104794006 TTTCTGGCCTCCCGAGGCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1122904062_1122904072 22 Left 1122904062 14:104793933-104793955 CCAACATGGGTCTTTCCACAGCC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1122904072 14:104793978-104794000 GCCACCTTTCTGGCCTCCCGAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1122904062_1122904065 0 Left 1122904062 14:104793933-104793955 CCAACATGGGTCTTTCCACAGCC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1122904065 14:104793956-104793978 AGCTTAGACGCTCTCCCCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122904062 Original CRISPR GGCTGTGGAAAGACCCATGT TGG (reversed) Exonic
900423173 1:2564478-2564500 GGGTGTGGAGAGGCCCATGCAGG + Intronic
903261765 1:22135497-22135519 GGCTCTAGAAAGACCCATCAAGG - Intronic
903649265 1:24913175-24913197 GGCTGGGGAAAGCCCCGCGTTGG + Intronic
904015581 1:27417781-27417803 AGCTTTGGAAAGACCCCTTTGGG + Intronic
905916522 1:41688440-41688462 GGCTGGGGAGGGACCGATGTGGG - Intronic
906934933 1:50206223-50206245 GGCTGTGGAAGGATCCAGGCAGG - Intergenic
909489015 1:76205913-76205935 GGCTGTGGTAAGAATCATGAGGG - Intronic
914343555 1:146779639-146779661 GGCTGTGGCCAGACCCAACTGGG - Intergenic
915008134 1:152659590-152659612 GGCTCTCGACAGAACCATGTGGG - Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
916348065 1:163816803-163816825 TGCAGTGGAAAGTCCCATGAGGG - Intergenic
916650965 1:166834127-166834149 GACTCTGGTAAAACCCATGTTGG - Intergenic
918247534 1:182672818-182672840 GGCAGTGTGAAGACCCATGTGGG - Exonic
919128529 1:193426208-193426230 GGCTGTGGCTGGAACCATGTGGG + Intergenic
922199084 1:223386093-223386115 GGCCGTGCAGAGACCCAGGTAGG + Intergenic
923173892 1:231445133-231445155 GGCAGTGGGAAGAGCCCTGTAGG + Intergenic
923710244 1:236382848-236382870 GGCTGGGGAAAGAACCATGTGGG - Intronic
1062925769 10:1314485-1314507 GGCCGTGGAAGGGCCGATGTGGG - Intronic
1064214011 10:13384266-13384288 GGCTGGGGGAAGACCCAGCTGGG + Intergenic
1067267058 10:44755706-44755728 AGCTTCGTAAAGACCCATGTGGG - Intergenic
1070512882 10:77177121-77177143 GCCTCTGGAGAGACCCATGTTGG + Intronic
1070533832 10:77360750-77360772 TGCTGTGGAAAGGGCCAGGTAGG - Intronic
1073046193 10:100639987-100640009 GGCTTTGGACAGACCCACTTTGG - Intergenic
1074685797 10:115961426-115961448 AGCAGTGGAAAGAGCCATGAAGG - Intergenic
1076401525 10:130188631-130188653 GGCTGTGGATGGGCCCATATTGG + Intergenic
1076764934 10:132627857-132627879 GGCCGTGGAGAGAGCCGTGTGGG + Intronic
1077894505 11:6443553-6443575 GGCTGAGGAAAGAAGCTTGTCGG + Intergenic
1078876835 11:15407768-15407790 GGCTGTGGAGAGATTCTTGTGGG + Intergenic
1088159588 11:106854090-106854112 GGCTGTGGGGTGACCCAGGTAGG + Intronic
1089742762 11:120596386-120596408 GGCTGTGGGAACACCGATGAGGG + Intronic
1089750774 11:120649598-120649620 AGCTGTGTAATGACCCATGCAGG - Intronic
1093419112 12:18954185-18954207 TGTTATGAAAAGACCCATGTGGG + Intergenic
1095924699 12:47566903-47566925 CCCTGTGGACAGACCCACGTGGG - Intergenic
1097263878 12:57735195-57735217 GGCTGTAGCAAACCCCATGTTGG + Intronic
1100825300 12:98469321-98469343 GCCTGTGGAAAGACCCACATAGG + Intergenic
1103552057 12:121744913-121744935 GGCTTTGGAAAAACACATCTTGG + Intronic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1104646305 12:130500157-130500179 GGCTCTGTAAAGAACCATGTGGG + Intronic
1104663871 12:130633764-130633786 GGCTGGGGAAAGAGCCCCGTGGG - Intronic
1106056986 13:26247230-26247252 GGCTGGGCAAAGACAGATGTTGG - Intergenic
1106146523 13:27054232-27054254 GGCTGTGGAAACACTCAGGAGGG + Intergenic
1107361062 13:39618415-39618437 AGTAGTGGAAAGAGCCATGTAGG + Intergenic
1107846859 13:44523812-44523834 GGGTGTGGAAAGACCCAAGGTGG + Intronic
1108119161 13:47164573-47164595 GGCTCTGGAAACACATATGTTGG - Intergenic
1112179548 13:97064474-97064496 GGCTGTGCAAGGACACCTGTTGG - Intergenic
1112399980 13:99068013-99068035 GGCTGTGGAGAACCACATGTGGG - Intronic
1112452397 13:99524414-99524436 GTCTGTGGGAAGAGCCAGGTTGG + Intronic
1117208010 14:53464565-53464587 GGCTGTGTAAACACAGATGTTGG + Intergenic
1119377589 14:74207040-74207062 GGCTGTGGCAGGACCCATGAAGG + Intergenic
1120193588 14:81460960-81460982 GGATGTGGAAAGAACAATGTTGG - Intergenic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1128069347 15:64784556-64784578 GGCTGTGGAATGAGCAATTTGGG - Intergenic
1130872426 15:87982042-87982064 GGCCCTGGAAAGATCCGTGTCGG + Intronic
1131463552 15:92637064-92637086 GGGTGTGGCCAGGCCCATGTGGG - Intronic
1133132361 16:3685144-3685166 GGCTGTGGAATGGGCCCTGTGGG - Intronic
1134101670 16:11456881-11456903 GGCAGTGGAAGGACACATCTCGG - Exonic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1138154420 16:54689544-54689566 GGCTGAAGGGAGACCCATGTGGG - Intergenic
1139990436 16:70935695-70935717 GGCTGTGGCCAGACCCAACTGGG + Intronic
1144255057 17:13459415-13459437 GGATGTGGAAAGAGGCATATGGG - Intergenic
1146935325 17:36809274-36809296 GGCTGGGGAGAGACCCCTGCTGG - Intergenic
1147044703 17:37744100-37744122 GGGTCTGGAAAGCCGCATGTCGG - Intronic
1147368720 17:39976668-39976690 GGCTGTTCAAAGACCCAGATGGG + Intronic
1147454818 17:40530638-40530660 GGCTTAGGCAAGACACATGTGGG + Intergenic
1148115420 17:45172234-45172256 AGCTGTGGAAAGGCCCAGGGAGG - Intergenic
1148468341 17:47878108-47878130 TGCTCTGGATAGACCCAAGTCGG - Intergenic
1148549672 17:48543142-48543164 GGCTGTCGAGAGAACCCTGTAGG + Exonic
1152290078 17:79435377-79435399 GCCTGTGGACAGCCACATGTGGG - Intronic
1152292068 17:79445679-79445701 GGCTTTGGAATGCCCCATCTTGG - Intronic
1152298283 17:79480968-79480990 GGTTGTGGAATGAACAATGTAGG + Intronic
1153756120 18:8285164-8285186 GTCAGTGGAAAAAACCATGTTGG - Intronic
1153770238 18:8409397-8409419 AGCTGTGGAAAGGCCCACATGGG - Intergenic
1154123885 18:11672868-11672890 AGCTGGGGACAGACCTATGTAGG - Intergenic
1154299888 18:13183877-13183899 GGCTGGGGAAAGTGTCATGTTGG + Intergenic
1156984347 18:43331505-43331527 GGCTGTGGAACTACTGATGTAGG - Intergenic
1158676759 18:59527378-59527400 TCCTGTGCAAAGACACATGTAGG - Intronic
1158804564 18:60954393-60954415 GAGTGTGGAAGCACCCATGTGGG - Intergenic
1159718397 18:71853663-71853685 GTCTTTGGAAACAACCATGTAGG - Intergenic
1161153861 19:2722353-2722375 GACTCTGGAGAGACCCCTGTGGG - Intronic
1163425777 19:17240378-17240400 GGCTGGGGAAAGTCCCTTGTGGG + Intronic
1167127851 19:47563360-47563382 GGCTGTGAAAAGCAACATGTAGG + Intergenic
1168024924 19:53637162-53637184 GTCTCTGGAAAGACCCCAGTAGG + Intergenic
924978148 2:196473-196495 GGCAGGGGAAAGTCCGATGTTGG + Intergenic
925197665 2:1939828-1939850 GGGTGTTGAAACACCCACGTGGG + Intronic
926435378 2:12832286-12832308 GGCTGAGGAACGAGCCATGTTGG - Intergenic
927247220 2:20967059-20967081 TGCTGGGGAAAGAGCCATGAGGG + Intergenic
927533385 2:23832296-23832318 GTCTGTGGAAAGGCCTATGCTGG - Intronic
931126407 2:59282977-59282999 GGCTGTGGGCAGACCTATCTGGG - Intergenic
932090068 2:68798614-68798636 AACTGTGAAAAGAGCCATGTGGG + Intronic
932343224 2:70979464-70979486 GGCTGTGGAAGGACCATTTTGGG + Intronic
932571901 2:72942612-72942634 GGCTTTGGAAAGACCTGTGAGGG - Exonic
936144025 2:109967215-109967237 GTCTGTGCACAGACCCATGAGGG + Intergenic
936180707 2:110265176-110265198 GTCTGTGCACAGACCCATGAGGG + Intergenic
936200662 2:110404254-110404276 GTCTGTGCACAGACCCATGAGGG - Intronic
945710955 2:213293543-213293565 GCCTGTGGAGAGACCCACATGGG + Intronic
946361210 2:219220278-219220300 GGCTGTGGCAAGCCCAGTGTTGG + Exonic
948147110 2:235716166-235716188 GGATGTGGACAGGCGCATGTTGG + Intronic
948591137 2:239050957-239050979 TGCAGTGGAAAAACCCAAGTGGG + Exonic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169892049 20:10463955-10463977 GGCTGGGGAAGGAAACATGTGGG + Intronic
1170242878 20:14189625-14189647 GGCTGAGGTCAGACCCATGATGG + Intronic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1174226494 20:49004999-49005021 TGCTGTTGAGAGACCCACGTCGG + Intronic
1175619021 20:60427615-60427637 GGGTGTGGGAAGACACAGGTGGG + Intergenic
1179390042 21:40980091-40980113 GGCTTTGGGAAGTCACATGTGGG + Intergenic
1180882822 22:19218648-19218670 GGGTGGGGCAAGACCAATGTTGG - Intronic
1181053775 22:20249834-20249856 TGCTGTGAAAAGACACGTGTGGG + Intronic
1181917200 22:26290836-26290858 GACTGTGTGAAGACCCATGGAGG - Intronic
1182501957 22:30754477-30754499 GGCTGAGGAGAGACTCATGTGGG + Intronic
1182585345 22:31341604-31341626 GGCTGGGCAAAGTCCCATGATGG + Intronic
1184865638 22:47200522-47200544 GGCTTTGGAAAGAGACATGAAGG + Intergenic
1185279718 22:49964846-49964868 GGCTGTGGGGTGCCCCATGTTGG + Intergenic
949915347 3:8958432-8958454 GACGCTGGAAAGACTCATGTTGG - Intronic
950200108 3:11036664-11036686 GGCTGTGGCGTGGCCCATGTGGG + Intronic
951587628 3:24231780-24231802 GGCTGTGGAAAGGACCATCTTGG - Intronic
952183333 3:30942142-30942164 AGCTGTGGGAAGAGCCCTGTAGG - Intergenic
953343924 3:42159594-42159616 GGCTGTGGAAACACAGATTTAGG + Intronic
954855119 3:53637591-53637613 GCCTGTGGAAAGGCCTGTGTGGG + Intronic
955516491 3:59731144-59731166 GGCTGTGGAGAGAACTAGGTGGG + Intergenic
956806937 3:72824027-72824049 GGCGGGGGGAAGACCCAAGTGGG - Intronic
956844158 3:73167031-73167053 GCCTGTGGAGAGGCCCATGTGGG - Intergenic
959143056 3:102509172-102509194 AGCTGTGGAAAGAACGAGGTGGG - Intergenic
959886522 3:111508575-111508597 GGCTGTGGCAAGGCCCAGGTAGG - Intronic
960973631 3:123156206-123156228 GGCTGGGGACAGGCCCATGCAGG + Intronic
960994294 3:123330837-123330859 GGCTGTGGACAGTCCCAGGGAGG + Intronic
961191830 3:124968659-124968681 AGCTGTGGGAAGAGCCATGTAGG - Exonic
961583619 3:127903707-127903729 GGGTGTGGAAAAGACCATGTAGG - Intergenic
965307599 3:167086124-167086146 GGCTGTGGAAAAGCCATTGTAGG + Intergenic
965956584 3:174377692-174377714 GGCTGAGGAAATAACCTTGTTGG - Intergenic
967240951 3:187439103-187439125 GGATGGGGAAAGACCCATATTGG + Intergenic
967818059 3:193815627-193815649 ATCTGAGGAAAGACCCATGTAGG + Intergenic
968100238 3:195959483-195959505 GGCTGTGAAAAGAACTCTGTGGG + Intergenic
968460406 4:721843-721865 GGGTGTGGAAAGAGGCCTGTGGG + Intronic
971373711 4:26039091-26039113 GGCAGTGGAGAGACCCAGGAGGG - Intergenic
972246316 4:37248418-37248440 TGCTGGAGAAGGACCCATGTGGG + Intronic
972275430 4:37552920-37552942 GACAATGGAGAGACCCATGTTGG - Intronic
980085063 4:128382465-128382487 GGATTTGGAAAGAGGCATGTTGG + Intergenic
982990012 4:162262210-162262232 TGCAGTGAAAAGACCCATTTGGG + Intergenic
984473185 4:180203398-180203420 TGCTATGGAAAGAGACATGTGGG + Intergenic
985669468 5:1200221-1200243 GGCTATGGAAGGAGCCATGTGGG + Intergenic
986279851 5:6314163-6314185 GGATGTGGGAACACCCATGAGGG - Intergenic
987440700 5:17952210-17952232 TGCAGTGGAAAGAGCCCTGTGGG - Intergenic
988875688 5:35443691-35443713 AGCAGTGGAAAGAGCCTTGTAGG + Intergenic
988889371 5:35598526-35598548 AGCAGTGGAAAGAGCCTTGTAGG + Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG + Intergenic
1000508074 5:162146833-162146855 GACAGTGGAAAGACTGATGTTGG - Intronic
1005109209 6:22260649-22260671 GGATGGGGAAAGCCCCATGGTGG - Intergenic
1009933027 6:70198961-70198983 TCCTGTGGAGAGGCCCATGTGGG - Intronic
1010294794 6:74183118-74183140 GGCAGTAGAAAGCTCCATGTGGG - Intergenic
1013080516 6:106808082-106808104 GGCTGTGGAGTGTCCCATCTTGG + Intergenic
1014657972 6:124131697-124131719 AGCAGTGGAAAGAGCCTTGTAGG + Intronic
1015862768 6:137697887-137697909 AGCTGTCCAAAGTCCCATGTTGG + Intergenic
1017043356 6:150325177-150325199 GGCAGGGCAAAGAGCCATGTGGG + Intergenic
1017063751 6:150509593-150509615 GGCTTTGGAAGCACCCATCTAGG - Intergenic
1018437993 6:163780798-163780820 CACTGTGGAAATACCAATGTAGG + Intergenic
1019908900 7:4086374-4086396 GGCTCTGGTGAGACCCATGCTGG - Intronic
1021337094 7:19417026-19417048 AGCTGTGGAAAGTGCCATGCAGG - Intergenic
1027599914 7:80227310-80227332 TGCTGTGAAAAGTCCCATTTAGG + Intergenic
1030323439 7:108194147-108194169 GGCTGTTTAACGATCCATGTAGG + Exonic
1033036072 7:137877500-137877522 GGCTGTGAAAAGAACCACGGTGG + Exonic
1034477893 7:151298252-151298274 GGCTGTGGCCACACCCATGATGG - Intergenic
1043498451 8:80828830-80828852 GACTCTGGAAAGTCTCATGTTGG - Intronic
1043537912 8:81226391-81226413 GGCTGCAGAAAGAGCCTTGTAGG - Intergenic
1043837002 8:85060036-85060058 GGCAGTAGTAAGCCCCATGTAGG + Intergenic
1044539213 8:93391179-93391201 CCCTATGGAGAGACCCATGTGGG - Intergenic
1044693340 8:94899925-94899947 GGATGTGGACAGCTCCATGTAGG - Intronic
1044916097 8:97113985-97114007 GGCTCTGGAAAGAGACAGGTAGG - Intronic
1047975790 8:130128983-130129005 GTCTGGGGAGAGACCCGTGTAGG + Intronic
1048246237 8:132804635-132804657 GGCTGTGGAAAGACCATCTTTGG - Exonic
1050103082 9:2138813-2138835 GGCCCTAGAAAGAACCATGTGGG + Intronic
1051048351 9:12901951-12901973 GGCTGTGGGCAGCCTCATGTGGG - Intergenic
1055155775 9:73061268-73061290 GGTTCTGGAAAGACACATGGGGG - Intronic
1056625955 9:88253430-88253452 GCCTGTGGAAAGACCTAGGAAGG + Intergenic
1056825393 9:89873315-89873337 GGCTGTGGATAGAGCCAGGTGGG - Intergenic
1059915871 9:119099432-119099454 TGCTGTGTAAAGAGCCATGATGG + Intergenic
1061850782 9:133413914-133413936 GGCTGAGGAATGAGCCATTTGGG - Intronic
1062183602 9:135204493-135204515 GGCAGTGGGAAGACACATGCTGG - Intergenic
1188875055 X:35419271-35419293 GGCTGAGGAAAGACAGAGGTGGG - Intergenic
1189289108 X:39872791-39872813 GGCTGTGGAAAGAGAGAGGTGGG - Intergenic
1191697547 X:64005387-64005409 TGCTGTGGGAAGGACCATGTGGG - Intergenic
1191932015 X:66383960-66383982 GGCTGGGGAAAGGCCCAGTTAGG - Intergenic
1194224992 X:91245205-91245227 GGCAGTGGGAAGAGCCCTGTAGG - Intergenic
1199746513 X:150775201-150775223 GGGTAGGGAAAGACCCACGTGGG + Intronic
1200428953 Y:3054832-3054854 AGCAGTGGAAAGAGCCCTGTAGG - Intergenic
1200561456 Y:4708515-4708537 GGCAGTGGGAAGAGCCCTGTAGG - Intergenic
1202337919 Y:23829970-23829992 GGCTGTGGAAAGAACACTGCAGG - Intergenic
1202532847 Y:25840101-25840123 GGCTGTGGAAAGAACACTGCAGG + Intergenic