ID: 1122904553

View in Genome Browser
Species Human (GRCh38)
Location 14:104795770-104795792
Sequence TCCGGGCGCGGGGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122904553_1122904567 9 Left 1122904553 14:104795770-104795792 CCCGCGCCCGCCCCGCGCCCGGA No data
Right 1122904567 14:104795802-104795824 CCACATCCGCCTCCGCCGCCCGG No data
1122904553_1122904569 11 Left 1122904553 14:104795770-104795792 CCCGCGCCCGCCCCGCGCCCGGA No data
Right 1122904569 14:104795804-104795826 ACATCCGCCTCCGCCGCCCGGGG No data
1122904553_1122904575 27 Left 1122904553 14:104795770-104795792 CCCGCGCCCGCCCCGCGCCCGGA No data
Right 1122904575 14:104795820-104795842 CCCGGGGCGTCCCCACCGCGCGG No data
1122904553_1122904568 10 Left 1122904553 14:104795770-104795792 CCCGCGCCCGCCCCGCGCCCGGA No data
Right 1122904568 14:104795803-104795825 CACATCCGCCTCCGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122904553 Original CRISPR TCCGGGCGCGGGGCGGGCGC GGG (reversed) Intergenic