ID: 1122905694

View in Genome Browser
Species Human (GRCh38)
Location 14:104800590-104800612
Sequence CGCCCCGGCGGGGAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4704
Summary {0: 1, 1: 0, 2: 7, 3: 113, 4: 4583}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122905694_1122905708 16 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905708 14:104800629-104800651 ACGCGCGCCAGGGCCGCCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 76
1122905694_1122905703 5 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905703 14:104800618-104800640 CCCGCAGCTCCACGCGCGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 186
1122905694_1122905710 20 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905710 14:104800633-104800655 GCGCCAGGGCCGCCCTGGGGAGG 0: 1
1: 0
2: 3
3: 36
4: 347
1122905694_1122905705 6 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905705 14:104800619-104800641 CCGCAGCTCCACGCGCGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 106
1122905694_1122905711 21 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905711 14:104800634-104800656 CGCCAGGGCCGCCCTGGGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 369
1122905694_1122905709 17 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905709 14:104800630-104800652 CGCGCGCCAGGGCCGCCCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 152
1122905694_1122905707 15 Left 1122905694 14:104800590-104800612 CCCGCGCCCTCCCCGCCGGGGCG 0: 1
1: 0
2: 7
3: 113
4: 4583
Right 1122905707 14:104800628-104800650 CACGCGCGCCAGGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122905694 Original CRISPR CGCCCCGGCGGGGAGGGCGC GGG (reversed) Intronic
Too many off-targets to display for this crispr