ID: 1122905717

View in Genome Browser
Species Human (GRCh38)
Location 14:104800656-104800678
Sequence GCGCGCGCGCGAGCGGCGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122905713_1122905717 -9 Left 1122905713 14:104800642-104800664 CCGCCCTGGGGAGGGCGCGCGCG 0: 1
1: 0
2: 10
3: 10
4: 142
Right 1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 191
1122905704_1122905717 14 Left 1122905704 14:104800619-104800641 CCGCAGCTCCACGCGCGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 191
1122905712_1122905717 -3 Left 1122905712 14:104800636-104800658 CCAGGGCCGCCCTGGGGAGGGCG 0: 1
1: 0
2: 3
3: 41
4: 497
Right 1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 191
1122905701_1122905717 28 Left 1122905701 14:104800605-104800627 CCGGGGCGCGCTGCCCGCAGCTC 0: 1
1: 0
2: 1
3: 17
4: 246
Right 1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 191
1122905706_1122905717 6 Left 1122905706 14:104800627-104800649 CCACGCGCGCCAGGGCCGCCCTG 0: 1
1: 0
2: 0
3: 26
4: 222
Right 1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 191
1122905702_1122905717 15 Left 1122905702 14:104800618-104800640 CCCGCAGCTCCACGCGCGCCAGG 0: 1
1: 0
2: 2
3: 21
4: 181
Right 1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG 0: 1
1: 0
2: 1
3: 21
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122905717 Original CRISPR GCGCGCGCGCGAGCGGCGAC CGG Intronic
900113800 1:1020271-1020293 GCGCGCGCTGGAGCGGCGCGAGG + Exonic
900309815 1:2028325-2028347 GCGCGCGCGGAAGGGGCGGCGGG - Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903191558 1:21659385-21659407 GCGAGCGCGCGGCCGGTGACTGG - Intronic
904500154 1:30908594-30908616 GCGCGGGCGCGGGCGGCGGGCGG + Exonic
904618930 1:31764069-31764091 GCGGGCGGGCGGGCGGCGCCGGG + Intronic
904696639 1:32335254-32335276 GCGCGCCCGTGAGGGGCGAGAGG - Intronic
904769030 1:32870803-32870825 GCGCGAGCGCGAGCGGCCGCCGG - Exonic
904772141 1:32886445-32886467 GCGCGCGCGGCAGGGGCGGCAGG - Exonic
904837591 1:33349447-33349469 GCGCGGACGAGAGCCGCGACTGG + Intronic
904837728 1:33349819-33349841 GCGGGAGCGCGGGCGGCGGCCGG + Intronic
904837902 1:33350518-33350540 GCACGCGCGCGAGGGGCTGCGGG + Intronic
905803723 1:40861743-40861765 GGGCGTGCGCGGGCGGCGGCGGG + Exonic
907430036 1:54406295-54406317 GCGCGCGAGCGAGCGGAGAGCGG - Exonic
912717083 1:111990239-111990261 GCGCGCGCGTGAGCGGGGGGTGG + Intergenic
913222044 1:116667585-116667607 GCGGGGGCGCGGGCGGCGCCCGG - Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
917974792 1:180231568-180231590 GCGCGCGCGCGACAAGCGCCGGG + Intronic
921217728 1:212951448-212951470 GTGCGCGCGGGCGCGGCGAGGGG - Exonic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
923055899 1:230425933-230425955 GCGGGCGCGCGGGCGGCGGCCGG - Intergenic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063458519 10:6201597-6201619 GCCCGCGCCCAGGCGGCGACCGG - Intronic
1063929840 10:11018026-11018048 GCGCGCGTCCGAGCGGCCGCGGG - Exonic
1065099510 10:22320584-22320606 GGGCGCGCGCGGGCGACGGCTGG - Intronic
1067405950 10:46023542-46023564 CCGCGAGCGCCAGCGGGGACTGG - Intronic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1071997566 10:91163004-91163026 GCGCGCGCGCGTGGGGCGGTAGG - Intronic
1072021826 10:91410250-91410272 GCGCGCGCGGGGGCGGCCTCGGG + Intergenic
1074815417 10:117138243-117138265 GCGCGCGGGTCAGCGGCGACGGG + Intronic
1074830033 10:117241472-117241494 GAGCGCCCGCGAGCGCCGTCGGG - Intronic
1076554295 10:131311824-131311846 GGGCGCGGGCGGGCGGGGACCGG - Intergenic
1077053110 11:576555-576577 GAGCGCTCGCGAGCGGCTGCGGG + Exonic
1080283818 11:30586140-30586162 GGGCGCGCGGGGGCGGCGAGGGG + Intronic
1080551399 11:33376378-33376400 TCGCGCCGGCGCGCGGCGACAGG + Intergenic
1080628546 11:34052232-34052254 GCGCGCGCGCGACCCGCCAGCGG - Intronic
1081832148 11:46122339-46122361 GGGAGCGGGCGAGCGGCGGCCGG - Intergenic
1082003600 11:47408212-47408234 GCGCGCCCCCGTGCGGCCACGGG + Intronic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1085205793 11:74731274-74731296 GCGCGCGGGCTAGAGGCGGCCGG + Intronic
1089208887 11:116787786-116787808 GCGCGGCCGCGAGCGGCGGGTGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096159764 12:49367029-49367051 GCTCGCGCGCCACCGGAGACTGG - Intronic
1096700562 12:53380345-53380367 GGGCGCGCGCGAGGGCCGACCGG + Intronic
1098369190 12:69739079-69739101 GCGGGCGCGCGGGCGCCGAGGGG - Intronic
1105004339 12:132711402-132711424 GCGCGCCCGCGAGCTGCGTGCGG + Intronic
1106720088 13:32427797-32427819 GCGGGGGCGCAAGCGGCGCCCGG + Intronic
1108408081 13:50124563-50124585 GCGCGCGCGCGGGCTTCGGCGGG - Intronic
1113201065 13:107867593-107867615 GCGCGGGGGCGGGCGGCGGCGGG + Intergenic
1121595342 14:95157664-95157686 GCGGGCGCGCGCGCGGAGGCCGG + Intronic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122866114 14:104604747-104604769 GCCCGGGCGAGAGCGGCGGCGGG + Exonic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1124584365 15:30991650-30991672 GCGCCCGCCCGAGCGGGGAGGGG + Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1131186039 15:90275053-90275075 GCGCGGGCCCGGGCGGCGGCTGG - Exonic
1131367829 15:91854299-91854321 GGACGCGCGCGAGCTGCTACCGG - Intronic
1132527715 16:425890-425912 GCGGGCGCGCGCGGGGCGCCCGG - Exonic
1132719651 16:1309485-1309507 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1134438901 16:14285838-14285860 GGGCGCACGGGAGCGGCGCCAGG + Intergenic
1135517739 16:23149408-23149430 GCCAGCGAGCGAGCGGCGGCCGG + Intergenic
1136220409 16:28824117-28824139 GCGCGCGCGCCAGAGGCTCCCGG - Intronic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136923333 16:34350085-34350107 GCTCCAGAGCGAGCGGCGACAGG - Intergenic
1136981240 16:35061721-35061743 GCTCCAGAGCGAGCGGCGACAGG + Intergenic
1137454733 16:48609746-48609768 GGGCGCGCGGGGGCGGCGGCCGG + Intronic
1139468358 16:67165807-67165829 GCGCGGCCGCGAGCAGCTACTGG + Exonic
1139534209 16:67561961-67561983 CCGTGCCCGCGAGCGACGACTGG - Intergenic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1141797927 16:86287094-86287116 GCGCGGGAGTGAGCGGCGGCGGG - Intergenic
1141972341 16:87492450-87492472 GCGGGCGCGCGCGGGGCGCCGGG + Intergenic
1142169111 16:88611303-88611325 GCGCGAGCGCGAGCGGGAGCGGG + Exonic
1142623882 17:1180333-1180355 TCGCGGGCGGGAGCGGCGGCCGG + Intronic
1143584030 17:7842587-7842609 GAGCGCGAGCTGGCGGCGACTGG + Intronic
1144185211 17:12790021-12790043 TCGCGCCTGCGAGCGGCGCCTGG - Intronic
1147440330 17:40443657-40443679 GCGCGCGGGCGAGCGGCGGAGGG - Exonic
1147896590 17:43755500-43755522 GCGCGCGCGCAAGGTGCGCCTGG - Exonic
1147967248 17:44199834-44199856 GCGCGCGCGTGTGCCGCGACCGG + Intronic
1148909208 17:50931578-50931600 GTGCACGCGCGAGCGGCGCTGGG - Intergenic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1151477399 17:74351896-74351918 GCGCGCGCGGGGCCGGCGCCTGG + Exonic
1153900637 18:9614562-9614584 ACGCGCGCGGGAGGGGCGGCGGG + Intronic
1155130959 18:22933830-22933852 GCGCGCGCGCGAGCCGCAGTCGG - Exonic
1155654534 18:28177848-28177870 GCGCGCGAGTGAGCGGCGCAGGG - Intergenic
1157094996 18:44679619-44679641 GGACGCGGGCGGGCGGCGACGGG + Intergenic
1157279101 18:46334187-46334209 GCGCGGGCGCGGGCGGCGGCGGG - Intronic
1160025083 18:75209707-75209729 GCGCGTGCGGCAGCGGCGGCAGG - Intergenic
1160164114 18:76495320-76495342 GGGCGCGCGCGGGCGGCGCGAGG - Intergenic
1160853404 19:1205603-1205625 CCGGGCGCCCGAGCGGCGATTGG - Intronic
1160873255 19:1286390-1286412 GCGCGCGCGTGGGGGGCGCCCGG - Intronic
1161265156 19:3360341-3360363 GCGCGCGCGGCAGCGGGGCCGGG - Intronic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1162412990 19:10517603-10517625 GAGCGCGCCCCGGCGGCGACTGG + Intronic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1165851401 19:38852072-38852094 GCGCCGGCGCGAGGGGCGTCCGG - Intronic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1167375381 19:49108206-49108228 GAGCGAGCGCGAGCGGCGCCGGG + Exonic
1167466194 19:49652098-49652120 GCGGGAGCGGGAGCGGCGGCGGG - Exonic
1167509833 19:49890197-49890219 GCGCGCCCTCGCGCGGCGGCGGG + Exonic
1168151123 19:54449411-54449433 CGCCGCGCGCGAGCGTCGACAGG + Intronic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932180712 2:69643742-69643764 GCGCGCGGGGGAGGGGCGGCGGG - Intronic
935112185 2:100104355-100104377 GGGCGGGCGGGAGCGGCGAGGGG - Intronic
935820098 2:106886201-106886223 GCGCGCACCCGAGCGGCTGCCGG - Exonic
936122792 2:109760796-109760818 GGGCGGGCGGGAGCGGCGAGGGG + Intergenic
936221899 2:110610668-110610690 GGGCGGGCGGGAGCGGCGAGGGG - Intergenic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937221748 2:120346072-120346094 GCGCGGGCGCGGGCGGGGGCGGG + Intergenic
938414583 2:131093561-131093583 GCGCGAGCGCGAGCGCGGAGTGG + Intergenic
942034700 2:171999721-171999743 GCGAGCGCGCGAGCCGCGGCTGG + Exonic
945119481 2:206443473-206443495 GCGCGGGAGCGAGCGGCGCGGGG - Intergenic
945119487 2:206443498-206443520 GCGCGGGAGCGAGCGGCGCGGGG - Intergenic
946325342 2:218981957-218981979 GAGCGTGCGCGGGCGGCGGCTGG + Exonic
948047003 2:234952366-234952388 GCGCCCGGGGGAGCGGCGAGGGG - Intronic
948140863 2:235670841-235670863 GAGCGCGCGCGGGCGGCGGCCGG + Intronic
1169405084 20:5315894-5315916 GCGCGCGCCCGGGCTGGGACAGG + Intergenic
1170999136 20:21396315-21396337 GCTCGCGCTCGGGCGCCGACAGG + Exonic
1175215999 20:57391954-57391976 GCGCGCCCGGGAGAGGCGGCAGG - Intronic
1175856132 20:62122068-62122090 GCACGCGCGCGGGCGGGGCCTGG + Intergenic
1175859795 20:62143931-62143953 GGGCGGGCGCGCGCGGGGACGGG + Intronic
1176547956 21:8209464-8209486 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176555850 21:8253679-8253701 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176566887 21:8392499-8392521 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574787 21:8436713-8436735 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611401 21:8988006-8988028 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1178913950 21:36696812-36696834 GCGCGCGCGTGTACGGCGAAAGG + Intergenic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1182494204 22:30694872-30694894 GCGCGCGGCCGAGCGGCCAGTGG - Exonic
1182532273 22:30969496-30969518 GCGCGAGCGCCAACGGCCACCGG - Intergenic
1183486187 22:38088894-38088916 GCGAGCGCCCGGGCGGCGGCGGG - Exonic
1183486399 22:38089482-38089504 GCGGGGGCGCGAACGGCGGCGGG + Intronic
1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG + Intronic
1184153055 22:42649438-42649460 GCGGGCGCGGGGGCGGGGACCGG + Intronic
1184184822 22:42857407-42857429 GCGCACGCGCGTGCAGCGCCTGG - Intronic
1184276479 22:43411947-43411969 GCGCGCGGGCGGGCGGCGGAGGG + Intronic
1184479952 22:44740566-44740588 GCGCGCGCGCGAGAGTGGATGGG + Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203252835 22_KI270733v1_random:125764-125786 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260891 22_KI270733v1_random:170850-170872 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
950710558 3:14810593-14810615 GCGAGCGCGGGGGCGGCGGCTGG - Intergenic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
953326120 3:42013738-42013760 GGGCGCGCGGGGGCGGCGGCCGG - Intergenic
953410079 3:42685819-42685841 GCGCGCGGGCGAGCTGCACCTGG + Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
957865010 3:86012427-86012449 GCGCGCGGGCGAGGGGCGGGCGG - Intronic
962575501 3:136752063-136752085 GAGAGAGCGCGAGCGGCGAGCGG - Intronic
963897689 3:150703943-150703965 TCGCGCTCGCGAGAGCCGACCGG - Exonic
972738475 4:41867312-41867334 GCGGGCGCGCAGGCGGCGGCGGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
981061275 4:140427653-140427675 GCGCGTGCGCGTGCGGTGGCGGG + Exonic
985129048 4:186723720-186723742 GCGCGCCCCCGAGCAGGGACCGG + Exonic
985897111 5:2755238-2755260 TCGTGCGCGCGGGCGGCGAGGGG + Exonic
985996931 5:3602294-3602316 GGGCGCGCGCGAGTGGGGAAAGG + Intergenic
986748040 5:10761180-10761202 ACGCGCGCGCGTGGGGCGCCGGG + Exonic
987193178 5:15500163-15500185 GCCCGCGGGCGAGCTGCGCCGGG + Intergenic
991263474 5:64690824-64690846 GAGCCCGCGCGTGCGGCGGCTGG + Intronic
992431612 5:76716071-76716093 GCGCGGGCGCGAGCGAGGAAGGG - Exonic
992515991 5:77492510-77492532 GCACGCGCGGGAGCGCCGCCGGG + Exonic
993501811 5:88674429-88674451 GCGCGCGTGCGACCGGGTACGGG + Intergenic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1002184201 5:177446741-177446763 GCGTGCGCGCGCGCGGCAGCCGG - Intronic
1002512643 5:179732964-179732986 GCGGGCTCGCGCGCGGCGGCGGG - Exonic
1007383211 6:41503859-41503881 GCGCGCGCGGGAAGGGCGCCCGG + Intergenic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1015999516 6:139028999-139029021 GGGCGCGCGGAAGCTGCGACCGG + Intronic
1019109973 6:169702035-169702057 GCGTGGGCGCGAGGGGCGGCGGG - Intronic
1021451138 7:20784856-20784878 CCGCGCCGGCCAGCGGCGACGGG + Exonic
1022653559 7:32298496-32298518 GAGCCCCCGGGAGCGGCGACTGG - Intronic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1023405814 7:39833274-39833296 GCGCGCGAGCGAGCGGAGAGCGG + Intergenic
1027138275 7:75639393-75639415 GCGGGGGCGCGAGGGGAGACCGG + Intronic
1027774128 7:82443752-82443774 GAGAGCGCGCGAGCGCCGGCGGG - Exonic
1029640441 7:101816484-101816506 GTGCGCGCGCGAGCGGGGAGCGG + Intronic
1032013410 7:128360966-128360988 GCGCGCGCGCGTGCAGGGGCAGG - Intronic
1034147330 7:148884472-148884494 GTGCGCGCGCGGGCGGCGGCGGG + Intergenic
1034446192 7:151115397-151115419 GGGTGCGCGCGCGCGGCGGCCGG - Intronic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038644403 8:29350616-29350638 GCGCTGGCGCCAGTGGCGACAGG - Exonic
1038727663 8:30095610-30095632 GCGCGCGCGCGAGCCCGGAGGGG - Intronic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047423910 8:124728586-124728608 GCGCGCGCCCGAGAGGCGCGTGG + Intergenic
1049183025 8:141232802-141232824 GAGCGCTCGCGAGCTGCAACGGG + Intronic
1049724320 8:144138441-144138463 GCGCCCGCGCGGGCGGGGAGGGG + Intronic
1051896527 9:21994616-21994638 GCGCGCGCGCGGGCGGCTCAGGG + Intronic
1056985678 9:91361952-91361974 GCGCGCACGCGCACGGCGTCCGG + Intergenic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1059145632 9:111896984-111897006 GCGCGCTCGCGGGCGGCTGCGGG - Exonic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1061128208 9:128689737-128689759 GGGCGCGCGCGGGGGGCGCCGGG + Intronic
1062022576 9:134326389-134326411 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203469238 Un_GL000220v1:108915-108937 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203477059 Un_GL000220v1:152887-152909 GCGGGCGCGGGGGCGGCGGCCGG - Intergenic
1189534529 X:41923223-41923245 GCGGGCGGGCGGGCGGCGCCGGG - Intronic
1190024577 X:46912235-46912257 GCGGGTGCGGGAGCGGCGAGTGG + Intergenic
1197692989 X:129522965-129522987 GCGCGGGCGGGAGCGGCGCGGGG - Intronic
1197774661 X:130111135-130111157 GGGCGCGAGCGAGCCGCGAGGGG - Intergenic
1197873548 X:131082390-131082412 GCGGGCGCGGGGGCGGCGGCAGG + Intronic
1198388021 X:136147324-136147346 GCGCGCGCGCGGGAGACGGCCGG - Intergenic
1200100756 X:153688304-153688326 GGGGGCGCGCGGGCGGCGGCGGG - Exonic