ID: 1122906091 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:104802172-104802194 |
| Sequence | CCACGCCGTCGGGTGAGAGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 50 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 47} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122906091_1122906096 | 0 | Left | 1122906091 | 14:104802172-104802194 | CCGGCTCTCACCCGACGGCGTGG | 0: 1 1: 0 2: 1 3: 1 4: 47 |
||
| Right | 1122906096 | 14:104802195-104802217 | CACCCACCTGCCCGCTCTGTGGG | 0: 1 1: 0 2: 2 3: 18 4: 180 |
||||
| 1122906091_1122906095 | -1 | Left | 1122906091 | 14:104802172-104802194 | CCGGCTCTCACCCGACGGCGTGG | 0: 1 1: 0 2: 1 3: 1 4: 47 |
||
| Right | 1122906095 | 14:104802194-104802216 | GCACCCACCTGCCCGCTCTGTGG | 0: 1 1: 0 2: 2 3: 23 4: 225 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122906091 | Original CRISPR | CCACGCCGTCGGGTGAGAGC CGG (reversed) | Exonic | ||