ID: 1122906091

View in Genome Browser
Species Human (GRCh38)
Location 14:104802172-104802194
Sequence CCACGCCGTCGGGTGAGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122906091_1122906096 0 Left 1122906091 14:104802172-104802194 CCGGCTCTCACCCGACGGCGTGG 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1122906096 14:104802195-104802217 CACCCACCTGCCCGCTCTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 180
1122906091_1122906095 -1 Left 1122906091 14:104802172-104802194 CCGGCTCTCACCCGACGGCGTGG 0: 1
1: 0
2: 1
3: 1
4: 47
Right 1122906095 14:104802194-104802216 GCACCCACCTGCCCGCTCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122906091 Original CRISPR CCACGCCGTCGGGTGAGAGC CGG (reversed) Exonic