ID: 1122906172

View in Genome Browser
Species Human (GRCh38)
Location 14:104802574-104802596
Sequence GCCAGATGGCTCCACCCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122906167_1122906172 -1 Left 1122906167 14:104802552-104802574 CCAGGTGGAGGTCCCTGCTTGGG 0: 1
1: 0
2: 3
3: 11
4: 175
Right 1122906172 14:104802574-104802596 GCCAGATGGCTCCACCCTCCTGG 0: 1
1: 1
2: 1
3: 15
4: 187
1122906165_1122906172 4 Left 1122906165 14:104802547-104802569 CCTGACCAGGTGGAGGTCCCTGC 0: 1
1: 0
2: 2
3: 10
4: 163
Right 1122906172 14:104802574-104802596 GCCAGATGGCTCCACCCTCCTGG 0: 1
1: 1
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122906172 Original CRISPR GCCAGATGGCTCCACCCTCC TGG Exonic