ID: 1122907136

View in Genome Browser
Species Human (GRCh38)
Location 14:104806835-104806857
Sequence AAACTGAGCCAACTCTAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122907132_1122907136 -1 Left 1122907132 14:104806813-104806835 CCTTTATGGAAGATCCCTAAAGA No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907128_1122907136 11 Left 1122907128 14:104806801-104806823 CCACCACCACCACCTTTATGGAA No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907129_1122907136 8 Left 1122907129 14:104806804-104806826 CCACCACCACCTTTATGGAAGAT No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907131_1122907136 2 Left 1122907131 14:104806810-104806832 CCACCTTTATGGAAGATCCCTAA No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907124_1122907136 23 Left 1122907124 14:104806789-104806811 CCTCCACCTTCACCACCACCACC No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907130_1122907136 5 Left 1122907130 14:104806807-104806829 CCACCACCTTTATGGAAGATCCC No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907125_1122907136 20 Left 1122907125 14:104806792-104806814 CCACCTTCACCACCACCACCACC No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907123_1122907136 29 Left 1122907123 14:104806783-104806805 CCATCACCTCCACCTTCACCACC No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data
1122907126_1122907136 17 Left 1122907126 14:104806795-104806817 CCTTCACCACCACCACCACCTTT No data
Right 1122907136 14:104806835-104806857 AAACTGAGCCAACTCTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122907136 Original CRISPR AAACTGAGCCAACTCTAGGT CGG Intergenic
No off target data available for this crispr