ID: 1122907567

View in Genome Browser
Species Human (GRCh38)
Location 14:104808776-104808798
Sequence GGGACAGTCCTCCGTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122907567_1122907576 7 Left 1122907567 14:104808776-104808798 CCCAGGCCACGGAGGACTGTCCC No data
Right 1122907576 14:104808806-104808828 GCAGGAATGATTGAGCACCAAGG No data
1122907567_1122907577 17 Left 1122907567 14:104808776-104808798 CCCAGGCCACGGAGGACTGTCCC No data
Right 1122907577 14:104808816-104808838 TTGAGCACCAAGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122907567 Original CRISPR GGGACAGTCCTCCGTGGCCT GGG (reversed) Intergenic