ID: 1122911948

View in Genome Browser
Species Human (GRCh38)
Location 14:104834427-104834449
Sequence CAAAAGAATTAAATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122911948_1122911951 23 Left 1122911948 14:104834427-104834449 CCAGCCTCCATTTAATTCTTTTG No data
Right 1122911951 14:104834473-104834495 TTCAAATTTATGTTTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122911948 Original CRISPR CAAAAGAATTAAATGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr