ID: 1122913610

View in Genome Browser
Species Human (GRCh38)
Location 14:104845547-104845569
Sequence CCCGGAGTGTCCCCAACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122913610_1122913618 18 Left 1122913610 14:104845547-104845569 CCTGGTGTTGGGGACACTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1122913618 14:104845588-104845610 AAGCAGACTCAGACAGGGATTGG 0: 1
1: 0
2: 2
3: 22
4: 262
1122913610_1122913616 13 Left 1122913610 14:104845547-104845569 CCTGGTGTTGGGGACACTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1122913616 14:104845583-104845605 TCCAGAAGCAGACTCAGACAGGG 0: 1
1: 0
2: 4
3: 41
4: 406
1122913610_1122913615 12 Left 1122913610 14:104845547-104845569 CCTGGTGTTGGGGACACTCCGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1122913615 14:104845582-104845604 CTCCAGAAGCAGACTCAGACAGG 0: 1
1: 0
2: 3
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122913610 Original CRISPR CCCGGAGTGTCCCCAACACC AGG (reversed) Intergenic
901070836 1:6517417-6517439 CCCCCAGTGTCACCCACACCTGG + Intronic
901631971 1:10652388-10652410 CCTGCTGTGTCCCCAGCACCCGG + Intronic
902534634 1:17112457-17112479 CCCAGAGTGACCCCAGCTCCTGG + Intronic
903071018 1:20727057-20727079 CCAGGACTGTCCCCGACGCCGGG - Exonic
904037874 1:27568551-27568573 CACGGCGCGTCCCGAACACCAGG + Intronic
904082635 1:27881910-27881932 CCAGGAGTGGCCCCCACCCCAGG - Intronic
906026517 1:42678725-42678747 GCTGCTGTGTCCCCAACACCTGG + Intergenic
913252113 1:116920244-116920266 ACAGAAGTGTCCCCACCACCAGG + Intronic
915207510 1:154281292-154281314 CCCAGACTGTCTCCAACTCCTGG - Intergenic
916559234 1:165918626-165918648 CTCTTAGTGTCCCCAACACGTGG + Intergenic
921433832 1:215092750-215092772 CCCAGAGTCTCACCAAGACCAGG + Intronic
1066001124 10:31104778-31104800 CCCAGTGTGTCTCCAACTCCTGG - Intergenic
1070695118 10:78557328-78557350 CCTGGAGTGACCTCAACCCCTGG - Intergenic
1077213030 11:1382304-1382326 CTCTGGGTGTCCCCACCACCAGG - Intergenic
1077416279 11:2425756-2425778 CCAGGCGTGTCCCCAGCACAGGG + Intergenic
1083101472 11:60310909-60310931 CCCGGAGTTGGCCCAACCCCTGG + Intergenic
1083125597 11:60562759-60562781 CCAGGCTTGTCTCCAACACCTGG - Intergenic
1083302366 11:61745693-61745715 CCCGGAGTTTCCCCAGAAGCGGG + Exonic
1089533931 11:119149439-119149461 CCCGGGCTGTCCCCAAAGCCAGG - Intronic
1089700152 11:120239907-120239929 CCCGGAGTGGCGCCAACTCCTGG - Intronic
1090453109 11:126823872-126823894 CCCGGAGTGTGCTTAGCACCAGG - Intronic
1091551008 12:1534872-1534894 CCTGGAGTGTCCCCACCAGAGGG + Intronic
1094124435 12:27008193-27008215 CCAGAAGTCTCACCAACACCTGG + Intronic
1095431959 12:42144391-42144413 CCCGCCGCGTCCCCCACACCGGG + Intronic
1097361988 12:58668421-58668443 CCTGGACTTCCCCCAACACCTGG - Intronic
1102191663 12:110993364-110993386 CCCAGAGTGCCCCCAACTCTAGG - Intergenic
1102956844 12:117064468-117064490 CCCCCACTTTCCCCAACACCTGG + Intronic
1103547599 12:121713039-121713061 CCCTGACTGTCCCCACCGCCCGG - Intronic
1103929277 12:124440619-124440641 CCTGCTGTGTCCCCAGCACCTGG - Intronic
1105025827 12:132848354-132848376 CTCCGAGTCTCCCCAGCACCTGG + Intronic
1110848157 13:80213279-80213301 CCTGGCATGTCTCCAACACCTGG - Intergenic
1112581892 13:100683447-100683469 CCTGGGATGTCCCCCACACCTGG + Intergenic
1113939158 13:114009729-114009751 CCCGGGCTGTCCCTCACACCTGG + Intronic
1119544622 14:75462642-75462664 CCCCCAGTGTACCCAACACACGG - Intronic
1121514593 14:94541037-94541059 CCCAGAGTGTCAGCAGCACCAGG + Intergenic
1121534551 14:94682183-94682205 CCCGGCGTTTCCCTAACACCGGG - Intergenic
1121817265 14:96938256-96938278 CTCGGGGGGTCCCCAACCCCTGG + Intergenic
1122913610 14:104845547-104845569 CCCGGAGTGTCCCCAACACCAGG - Intergenic
1124712904 15:32030303-32030325 CCCGGAGCGTACCCAGCGCCGGG + Intergenic
1129220393 15:74128814-74128836 CCCTCAGGGTTCCCAACACCCGG + Intronic
1130518756 15:84646067-84646089 CACTGTGTATCCCCAACACCTGG + Intronic
1131370584 15:91877914-91877936 CCCTGTGTGGCCCCATCACCTGG - Intronic
1132752364 16:1464681-1464703 CCCGGGGTGTTGCCAACATCAGG + Intronic
1140229311 16:73104437-73104459 CCCAGAGTGGCCTCAACTCCTGG + Intergenic
1147141472 17:38463005-38463027 ACAGGAGCCTCCCCAACACCTGG - Intronic
1147897965 17:43763931-43763953 CCCCGACTTTCCCCAACCCCTGG + Intergenic
1148021795 17:44558208-44558230 CCCGGGGTGCCCCCGGCACCCGG - Exonic
1151229124 17:72669782-72669804 CCAGGAGGGTCTCCAACTCCTGG - Intronic
1152290073 17:79435365-79435387 CCCTGAGTGTCCCCCACATGTGG + Intronic
1152727682 17:81955769-81955791 CCTGCAGTGTCCCCCACCCCAGG + Intronic
1154232725 18:12572347-12572369 CCCCAACTGTCCCAAACACCTGG + Intronic
1158340903 18:56465241-56465263 CTAGGAGTGTCCCAAACACAGGG + Intergenic
1160705849 19:529894-529916 CCCGCAGGTGCCCCAACACCTGG - Intergenic
1160884943 19:1341429-1341451 CCCTGAGTGTCCCCTGCAGCAGG - Intergenic
1161273873 19:3404762-3404784 CCCAGAGCGTCCCCAGCACGGGG + Intronic
1163365937 19:16876240-16876262 CCCGGCGTGTTCCCAGCCCCAGG - Intronic
1163765896 19:19163039-19163061 CCCGGACTGTGTCCAACCCCGGG + Intronic
1165999968 19:39872021-39872043 CCAGGAGGGGCCCCTACACCTGG + Intronic
1166368981 19:42291124-42291146 CCCGCAGTGGTCCCACCACCAGG - Exonic
925414291 2:3658465-3658487 CCGGGCGTGGCCCAAACACCTGG + Intronic
927185185 2:20477214-20477236 CCCCCAGTTTCCCCAAAACCAGG + Intergenic
928440391 2:31287289-31287311 CCCTTTGTGTCCCCAACACCAGG - Intergenic
929762019 2:44814747-44814769 CCCTAAATGTCCCAAACACCAGG + Intergenic
944004167 2:194882111-194882133 CCCTGACTGTCCCCCACACCAGG + Intergenic
947623200 2:231604112-231604134 CCCCGACTGCCCCCAACCCCAGG + Intergenic
1170150764 20:13222951-13222973 CCAGGATAGTCTCCAACACCTGG - Intronic
1171520089 20:25769145-25769167 ACCCTAGTGTCCCCAGCACCAGG - Intronic
1171556830 20:26087348-26087370 ACCCTAGTGTCCCCAGCACCAGG + Intergenic
1172096804 20:32464355-32464377 CCCCGTGTGGCCCCATCACCCGG - Intronic
1172185765 20:33030181-33030203 CCCTGAGTGACCCTAACACCTGG + Intergenic
1172641235 20:36441586-36441608 CCTGCAGTGTCCCCAGTACCTGG + Intronic
1172802383 20:37585143-37585165 TCAGGAGTCTCCCCAACCCCTGG - Intergenic
1175656561 20:60776100-60776122 CCCTGCGTGTCCTCAACTCCTGG - Intergenic
1176380619 21:6110790-6110812 CCCGCAGTGCCCCCAGCGCCCGG + Intergenic
1176654221 21:9575421-9575443 ACCCTAGTGTCCCCAGCACCAGG - Intergenic
1178909555 21:36663599-36663621 CCTGGAGTGTGCCACACACCTGG + Intergenic
1179529629 21:42009909-42009931 CCAGGCGTGTCCCCTACCCCAGG + Intronic
1179742853 21:43427450-43427472 CCCGCAGTGCCCCCAGCGCCCGG - Intergenic
1183091461 22:35525200-35525222 CCCAGACTGTCCCCAGCTCCTGG + Intergenic
1183241040 22:36658653-36658675 CCTGCAGTGTACCCAGCACCTGG - Intronic
1184158731 22:42685653-42685675 CCCTCAGTGCCCCCAACAGCAGG - Intergenic
1185239919 22:49737002-49737024 CCCAGCTTGTCCCCAACCCCTGG + Intergenic
1185287359 22:50008520-50008542 CCTGCAGTGTCCCCAGCAGCTGG - Intronic
1185347086 22:50315177-50315199 CCCGAAGTGGCCCCAAAGCCGGG + Intronic
950211527 3:11126933-11126955 CCCAGGGTGTCCCCTCCACCCGG - Intergenic
952818610 3:37466825-37466847 GCCTGAGTGTCCCCACCAACAGG - Intronic
952866693 3:37860199-37860221 CCAGGACTGTCTCCCACACCTGG + Intergenic
953317167 3:41939683-41939705 CCAGGGGGGTCCCCAACTCCTGG + Intronic
954410225 3:50367362-50367384 CCCGCAGTGTGCCCAGCAGCAGG - Intronic
954688952 3:52385701-52385723 CCCGGAGTCTGCCCAGCACAGGG + Intronic
958814494 3:98901269-98901291 CCCGCAGTGTCCCCAAGTCCGGG - Exonic
960102067 3:113754311-113754333 CCAGGATGGTCTCCAACACCGGG - Intronic
961577254 3:127847620-127847642 CTCGCTGTATCCCCAACACCTGG - Intergenic
969386210 4:6850267-6850289 CCAGCTGTGCCCCCAACACCTGG - Intronic
969492260 4:7506114-7506136 CCCGGAGTGTCCCTACCACTGGG - Intronic
976137542 4:81954974-81954996 CCCGGGATGTCCCCAAGTCCAGG - Intronic
978554598 4:109965695-109965717 CCAGCAGTGTCAACAACACCTGG + Intronic
983198427 4:164834291-164834313 CCAGGAGGGTCTCCAACTCCTGG - Intergenic
985020776 4:185687235-185687257 CCAGGCTTGTCTCCAACACCTGG + Intronic
985489439 5:170856-170878 ATCAGAGTATCCCCAACACCAGG - Intronic
987426140 5:17775195-17775217 CCAGGAGAGTCTCAAACACCTGG + Intergenic
992069420 5:73135874-73135896 CCCTCAGTGCCCCCAACCCCTGG + Intergenic
992386083 5:76285883-76285905 CCCAGAGAATCCTCAACACCAGG + Intronic
996171054 5:120292307-120292329 CCCCAAGTGCCCCCAGCACCTGG - Intergenic
998197926 5:140092064-140092086 GCCTGAGTGTCCCCAAGACCAGG + Intergenic
1002640097 5:180626647-180626669 CCAGGAGGGTCCCACACACCTGG + Intronic
1006151345 6:31991837-31991859 TTCAGAGTGTCCCCAACACGAGG - Exonic
1006157646 6:32024575-32024597 TTCAGAGTGTCCCCAACACGAGG - Exonic
1009997089 6:70907776-70907798 CCAGGAGAGTCACCAACCCCTGG + Intronic
1013555454 6:111252517-111252539 CCAGGCTTGTCCCCAACCCCTGG - Intergenic
1017166773 6:151415891-151415913 CCCGGACTGTCCCTAACCCCTGG - Intronic
1018730372 6:166645650-166645672 CCTGGAGTGCCCCCATCTCCAGG - Intronic
1021890836 7:25184872-25184894 CCCGGACTGTCCTCATCAGCTGG - Intergenic
1025280572 7:57624089-57624111 ACCCTAGTGTCCCCAGCACCAGG - Intergenic
1025304158 7:57841418-57841440 ACCCTAGTGTCCCCAGCACCAGG + Intergenic
1028889800 7:95974293-95974315 CCTGGTGTGTGCCCAGCACCTGG + Intronic
1029457851 7:100679952-100679974 ACAGGAGTCTCCCCCACACCTGG + Exonic
1031980804 7:128123096-128123118 CCTGGGTTGTCCCCAACATCGGG + Intergenic
1032718953 7:134535185-134535207 CCAGGATGGTCTCCAACACCTGG + Intronic
1033540593 7:142352508-142352530 CCAACAGTGCCCCCAACACCAGG - Intergenic
1033630522 7:143153252-143153274 CCCTGAGTGTCCCCTTCACCTGG + Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1035021370 7:155803015-155803037 CCCGGAGCGTCGGCAGCACCTGG + Exonic
1035079182 7:156202116-156202138 CCCAGTGTGTCCCAAACAACCGG + Intergenic
1035327575 7:158074951-158074973 CCCCGAGTGTCCCCCACATGCGG + Intronic
1039457639 8:37718070-37718092 CCAGTAGTGTCACCATCACCTGG + Intergenic
1048296720 8:133220269-133220291 CCTGCAGGGTCCCCAGCACCAGG - Intronic
1048355368 8:133649410-133649432 GCCAGAGTGTCCCTAAAACCAGG + Intergenic
1059388444 9:113983685-113983707 CCTGGAGTGCCCTTAACACCTGG - Intronic
1061008866 9:127943630-127943652 CCCCGAGAGTCCCCGACTCCAGG - Intronic
1061303352 9:129718836-129718858 ACCTGAGTGTCCCCAGCACCCGG - Intronic
1061815575 9:133192540-133192562 ACCAGCATGTCCCCAACACCTGG - Intergenic
1062524362 9:136972319-136972341 CCCGCAGTGTCCCCCACACCTGG - Intergenic
1203631942 Un_KI270750v1:78879-78901 ACCCTAGTGTCCCCAGCACCAGG - Intergenic
1185464498 X:346518-346540 ACCAGAGTCCCCCCAACACCGGG + Intronic
1188551730 X:31372163-31372185 CCAGGAGTGTCCCAGACATCAGG - Intronic
1194681349 X:96857705-96857727 CCAGGAGTAGCCCAAACACCTGG + Intronic
1195702568 X:107716267-107716289 CCCGGGGAGTCCCCCACAGCCGG + Intronic
1197083120 X:122441657-122441679 TCCAGATTGTCCCCAGCACCAGG - Intergenic
1199272785 X:145904691-145904713 CCAGGTCTCTCCCCAACACCTGG - Intergenic