ID: 1122913713

View in Genome Browser
Species Human (GRCh38)
Location 14:104846156-104846178
Sequence CTGGGAAGGGAAGGTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122913713_1122913726 27 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913713_1122913722 12 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913722 14:104846191-104846213 AGGTGATGAGATGTCGCTGCTGG No data
1122913713_1122913723 15 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913723 14:104846194-104846216 TGATGAGATGTCGCTGCTGGTGG No data
1122913713_1122913725 23 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913725 14:104846202-104846224 TGTCGCTGCTGGTGGGTGACAGG No data
1122913713_1122913724 16 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913724 14:104846195-104846217 GATGAGATGTCGCTGCTGGTGGG No data
1122913713_1122913718 -8 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913718 14:104846171-104846193 CTTCCCAGGATTTAGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122913713 Original CRISPR CTGGGAAGGGAAGGTCCCTC TGG (reversed) Intergenic
No off target data available for this crispr